Login to display prices
Login to display prices
LMO3-LIM domain only 3 (rhombotin-like 2) Gene View larger

LMO3-LIM domain only 3 (rhombotin-like 2) Gene

PTXBC026311

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LMO3-LIM domain only 3 (rhombotin-like 2) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LMO3-LIM domain only 3 (rhombotin-like 2) Gene

Proteogenix catalog: PTXBC026311
Ncbi symbol: LMO3
Product name: LMO3-LIM domain only 3 (rhombotin-like 2) Gene
Size: 2ug
Accessions: BC026311
Gene id: 55885
Gene description: LIM domain only 3 (rhombotin-like 2)
Synonyms: RBTN3; RBTNL2; RHOM3; Rhom-3; LIM domain only protein 3; LIM domain only 3 (rhombotin-like 2); neuronal-specific transcription factor DAT1; rhombotin-3; LIM domain only 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctctcagtccagccagacaccaagccgaaaggttgtgctggctgcaaccgaaagatcaaggaccggtatcttctaaaggcactggacaaatactggcatgaagactgcctgaagtgtgcctgctgtgactgtcgcttgggagaggtgggctccaccctgtacactaaagctaatcttatcctttgtcgcagagactatctgaggctctttggtgtaacgggaaactgcgctgcctgtagtaagctcatccctgcctttgagatggtgatgcgtgccaaggacaatgtttaccacctggactgctttgcatgtcagctttgtaatcagagattttgtgttggagacaaatttttcctaaagaataacatgatcctttgccagacggactacgaggaaggtttaatgaaagaaggttatgcaccccaggttcgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: