Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of LMO3-LIM domain only 3 (rhombotin-like 2) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LMO3-LIM domain only 3 (rhombotin-like 2) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC026311 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LMO3 |
| Origin species: | Human |
| Product name: | LMO3-LIM domain only 3 (rhombotin-like 2) Gene |
| Size: | 2ug |
| Accessions: | BC026311 |
| Gene id: | 55885 |
| Gene description: | LIM domain only 3 (rhombotin-like 2) |
| Synonyms: | RBTN3; RBTNL2; RHOM3; Rhom-3; LIM domain only protein 3; LIM domain only 3 (rhombotin-like 2); neuronal-specific transcription factor DAT1; rhombotin-3; LIM domain only 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctctcagtccagccagacaccaagccgaaaggttgtgctggctgcaaccgaaagatcaaggaccggtatcttctaaaggcactggacaaatactggcatgaagactgcctgaagtgtgcctgctgtgactgtcgcttgggagaggtgggctccaccctgtacactaaagctaatcttatcctttgtcgcagagactatctgaggctctttggtgtaacgggaaactgcgctgcctgtagtaagctcatccctgcctttgagatggtgatgcgtgccaaggacaatgtttaccacctggactgctttgcatgtcagctttgtaatcagagattttgtgttggagacaaatttttcctaaagaataacatgatcctttgccagacggactacgaggaaggtttaatgaaagaaggttatgcaccccaggttcgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - coiled-coil domain containing 28A - BCL2-associated agonist of cell death - keratin associated protein 4-12 - nuclear transcription factor Y, beta |