Login to display prices
Login to display prices
CCDC28A-coiled-coil domain containing 28A Gene View larger

CCDC28A-coiled-coil domain containing 28A Gene

PTXBC000758

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCDC28A-coiled-coil domain containing 28A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CCDC28A-coiled-coil domain containing 28A Gene

Proteogenix catalog: PTXBC000758
Ncbi symbol: CCDC28A
Product name: CCDC28A-coiled-coil domain containing 28A Gene
Size: 2ug
Accessions: BC000758
Gene id: 25901
Gene description: coiled-coil domain containing 28A
Synonyms: CCRL1AP; coiled-coil domain-containing protein 28A; chemokine C-C motif receptor-like 1 adjacent; coiled-coil domain containing 28A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccaaaaaaaaatgccattccagtgagtaaaagcacagggttttcaaatcctgcatcacagtcaacttcacagcgaccaaagttaaaaagagtgatgaaagaaaagaccaaacctcagggtggagagggcaaaggcgctcagtcaactccgatccagcactccttcctcactgatgtctcagatgttcaggagatggagagagggctgctcagtcttttgaatgatttccactctggaaaacttcaagcatttggaaatgaatgttccattgaacagatggaacatgttcggggaatgcaggagaaattagctcgcttgaatttggagctctatggggagttagaggaacttcctgaggataagagaaaaacagccagtgactccaatctggataggcttctgtcagatttagaagaattgaattcttccatacaaaaactccatttggcagatgcacaagatgttccaaatacttctgctagctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: