FAM107A-family with sequence similarity 107, member A Gene View larger

FAM107A-family with sequence similarity 107, member A Gene

PTXBC010561

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM107A-family with sequence similarity 107, member A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM107A-family with sequence similarity 107, member A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010561
Product type: DNA & cDNA
Ncbi symbol: FAM107A
Origin species: Human
Product name: FAM107A-family with sequence similarity 107, member A Gene
Size: 2ug
Accessions: BC010561
Gene id: 11170
Gene description: family with sequence similarity 107, member A
Synonyms: protein FAM107A; DRR1; TU3A; down-regulated in renal cell carcinoma 1; family with sequence similarity 107 member A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtactcggagatccagagggagcgggcagacattgggggcctgatggcccggccagaatacagagagtggaatccggagctcatcaagcccaagaagctgctgaaccccgtgaaggcctctcggagtcaccaggagctccaccgggagctgctcatgaaccacagaaggggccttggtgtggacagcaagccagagctgcagcgtgtcctagagcaccgccggcggaaccagctcatcaagaagaagaaggaggagctggaagccaagcggctgcagtgcccctttgagcaggagctgctgagacggcagcagaggctgaaccagctggaaaaaccaccagagaaggaagaggatcacgcccccgagtttattaaagtcagggaaaacctgcggagaattgccacactgaccagcgaagagagagagctgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - growth arrest and DNA-damage-inducible, gamma
- ADP-ribosylation factor-like 2 binding protein
- family with sequence similarity 158, member A
- monocyte to macrophage differentiation-associated

Buy FAM107A-family with sequence similarity 107, member A Gene now

Add to cart