C1D-nuclear DNA-binding protein Gene View larger

C1D-nuclear DNA-binding protein Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C1D-nuclear DNA-binding protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C1D-nuclear DNA-binding protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009584
Product type: DNA & cDNA
Ncbi symbol: C1D
Origin species: Human
Product name: C1D-nuclear DNA-binding protein Gene
Size: 2ug
Accessions: BC009584
Gene id: 10438
Gene description: nuclear DNA-binding protein
Synonyms: C1D nuclear receptor corepressor; C1D nuclear receptor co-repressor; C1D DNA-binding protein; nuclear nucleic acid-binding protein C1D; LRP1; Rrp47; SUN-CoR; SUNCOR; hC1D; nuclear DNA-binding protein; small unique nuclear receptor co-repressor; small unique nuclear receptor corepressor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaggtgaagaaattaatgaagactatccagtagaaattcacgagtatttgtcagcgtttgagaattccattggtgctgtggatgagatgctgaagaccatgatgtctgtttctagaaatgagttgttgcagaagttggatccacttgaacaagcaaaagtggatttggtttctgcatacacattaaattcaatgttttgggtttatttggcaacccaaggagttaatcctaaggaacatccagtaaaacaggaattggaaagaatcagagtatatatgaacagagtcaaggaaataacagacaagaaaaaggctggcaagctggacagaggtgcagcttcaagatttgtaaaaaatgccctctgggaaccaaaatcgaaaaatgcatcaaaagttgccaataaaggaaaaagtaaaagttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DAZ associated protein 2
- transmembrane protein 44
- SCAN domain containing 1
- acireductone dioxygenase 1

Buy C1D-nuclear DNA-binding protein Gene now

Add to cart