Login to display prices
Login to display prices
TGS1-trimethylguanosine synthase homolog (S. cerevisiae) Gene View larger

TGS1-trimethylguanosine synthase homolog (S. cerevisiae) Gene

PTXBC011999

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TGS1-trimethylguanosine synthase homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TGS1-trimethylguanosine synthase homolog (S. cerevisiae) Gene

Proteogenix catalog: PTXBC011999
Ncbi symbol: TGS1
Product name: TGS1-trimethylguanosine synthase homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC011999
Gene id: 96764
Gene description: trimethylguanosine synthase homolog (S. cerevisiae)
Synonyms: NCOA6IP; PIMT; PIPMT; trimethylguanosine synthase; CLL-associated antigen KW-2; PRIP-interacting protein with methyltransferase motif; cap-specific guanine-N2 methyltransferase; hepatocellular carcinoma-associated antigen 137; nuclear receptor coactivator 6-interacting protein; trimethylguanosine synthase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagagtgattgccattgatatcgatcctgttaagattgcccttgctcgcaataatgcagaagtttatgggatagcagataagatagagttcatctgtggagatttcttgctgctggcttcttttttaaaggctgatgttgtgttcctcagcccaccttggggagggccagactatgccactgcagagacctttgacattagaacaatgatgtctcctgatggctttgaaattttcagactttctaagaagatcactaataatattgtttattttcttccaagaaatgctgatattgaccaggtggcatccttagctgggcctggagggcaagtggaaatagaacagaacttccttaacaacaaattgaagacaatcactgcatattttggtgacctaattcgaagaccagcctctgaaacctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: