TGS1-trimethylguanosine synthase homolog (S. cerevisiae) Gene View larger

TGS1-trimethylguanosine synthase homolog (S. cerevisiae) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TGS1-trimethylguanosine synthase homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TGS1-trimethylguanosine synthase homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011999
Product type: DNA & cDNA
Ncbi symbol: TGS1
Origin species: Human
Product name: TGS1-trimethylguanosine synthase homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC011999
Gene id: 96764
Gene description: trimethylguanosine synthase homolog (S. cerevisiae)
Synonyms: NCOA6IP; PIMT; PIPMT; trimethylguanosine synthase; CLL-associated antigen KW-2; PRIP-interacting protein with methyltransferase motif; cap-specific guanine-N2 methyltransferase; hepatocellular carcinoma-associated antigen 137; nuclear receptor coactivator 6-interacting protein; trimethylguanosine synthase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagagtgattgccattgatatcgatcctgttaagattgcccttgctcgcaataatgcagaagtttatgggatagcagataagatagagttcatctgtggagatttcttgctgctggcttcttttttaaaggctgatgttgtgttcctcagcccaccttggggagggccagactatgccactgcagagacctttgacattagaacaatgatgtctcctgatggctttgaaattttcagactttctaagaagatcactaataatattgtttattttcttccaagaaatgctgatattgaccaggtggcatccttagctgggcctggagggcaagtggaaatagaacagaacttccttaacaacaaattgaagacaatcactgcatattttggtgacctaattcgaagaccagcctctgaaacctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - actin related protein 2/3 complex, subunit 5-like
- CCHC-type zinc finger, nucleic acid binding protein
- holocytochrome c synthase (cytochrome c heme-lyase)
- basic leucine zipper transcription factor, ATF-like

Buy TGS1-trimethylguanosine synthase homolog (S. cerevisiae) Gene now

Add to cart