Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
POP7-processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae) Gene
PTXBC001430
New product
Data sheet of POP7-processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about POP7-processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001430 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | POP7 |
| Origin species: | Human |
| Product name: | POP7-processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC001430 |
| Gene id: | 10248 |
| Gene description: | processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae) |
| Synonyms: | POP7 homolog, ribonuclease P/MRP subunit; ribonucleases P/MRP protein subunit POP7 homolog; POP7 (processing of precursor, S. cerevisiae) homolog; 0610037N12Rik; RPP2; RPP20; ribonuclease P protein subunit p20; RNaseP protein p20; hPOP7; processing of precursor 7, ribonuclease P subunit; processing of precursor 7, ribonuclease P/MRP subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagaaaaccgagagccccgcggtgctgtggaggctgaactggatccagtggaatacacccttaggaaaaggcttcccagccgcctgccccggagacccaatgacatttatgtcaacatgaagacggactttaaggcccagctggcccgctgccagaagctgctggacggaggggcccggggtcagaacgcgtgctctgagatctacattcacggcttgggcctggccatcaaccgcgccatcaacatcgcgctgcagctgcaggcgggcagcttcgggtccttgcaggtggctgccaatacctccaccgtggagcttgttgatgagctggagccagagaccgacacacgggagccactgactcggatccgcaacaactcagccatccacatccgagtcttcagggtcacacccaagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - inhibitor of DNA binding 1, dominant negative helix-loop-helix protein - COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis) - processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae) - processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) |