POP7-processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae) Gene View larger

POP7-processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of POP7-processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about POP7-processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001430
Product type: DNA & cDNA
Ncbi symbol: POP7
Origin species: Human
Product name: POP7-processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae) Gene
Size: 2ug
Accessions: BC001430
Gene id: 10248
Gene description: processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae)
Synonyms: POP7 homolog, ribonuclease P/MRP subunit; ribonucleases P/MRP protein subunit POP7 homolog; POP7 (processing of precursor, S. cerevisiae) homolog; 0610037N12Rik; RPP2; RPP20; ribonuclease P protein subunit p20; RNaseP protein p20; hPOP7; processing of precursor 7, ribonuclease P subunit; processing of precursor 7, ribonuclease P/MRP subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagaaaaccgagagccccgcggtgctgtggaggctgaactggatccagtggaatacacccttaggaaaaggcttcccagccgcctgccccggagacccaatgacatttatgtcaacatgaagacggactttaaggcccagctggcccgctgccagaagctgctggacggaggggcccggggtcagaacgcgtgctctgagatctacattcacggcttgggcctggccatcaaccgcgccatcaacatcgcgctgcagctgcaggcgggcagcttcgggtccttgcaggtggctgccaatacctccaccgtggagcttgttgatgagctggagccagagaccgacacacgggagccactgactcggatccgcaacaactcagccatccacatccgagtcttcagggtcacacccaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - inhibitor of DNA binding 1, dominant negative helix-loop-helix protein
- COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis)
- processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae)
- processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae)

Buy POP7-processing of precursor 7, ribonuclease P/MRP subunit (S. cerevisiae) Gene now

Add to cart