Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of TAC1-tachykinin, precursor 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TAC1-tachykinin, precursor 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018047 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TAC1 |
| Origin species: | Human |
| Product name: | TAC1-tachykinin, precursor 1 Gene |
| Size: | 2ug |
| Accessions: | BC018047 |
| Gene id: | 6863 |
| Gene description: | tachykinin, precursor 1 |
| Synonyms: | Hs.2563; NK2; NKNA; NPK; TAC2; protachykinin-1; PPT; neurokinin 1; neurokinin 2; neurokinin A; neurokinin alpha; neuromedin L; neuropeptide K; neuropeptide gamma; preprotachykinin; protachykinin; substance K; tachykinin 2; tachykinin, precursor 1 (substance K, substance P, neurokinin 1, neurokinin 2, neuromedin L, neurokinin alpha, neuropeptide K, neuropeptide gamma); tachykinin precursor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaaatcctcgtggccttggcagtcttttttcttgtctccactcagctgtttgcagaagaaataggagccaatgatgatctgaattactggtccgactggtacgacagcgaccagatcaaggaggaactgccggagccctttgagcatcttctgcagagaatcgcccggagacccaagcctcagcagttctttggattaatgggcaaacgggatgctgattcctcaattgaaaaacaagtggccctgttaaaggctctttatggacatggccagatctctcacaaaagacataaaacagattcctttgttggactaatgggcaaaagagctttaaattctgtggcttatgaaaggagtgcaatgcagaattatgaaagaagacgttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ring finger protein 24 - zinc finger protein 44 - male-enhanced antigen 1 - dihydrofolate reductase |