TAC1-tachykinin, precursor 1 Gene View larger

TAC1-tachykinin, precursor 1 Gene

PTXBC018047

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TAC1-tachykinin, precursor 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TAC1-tachykinin, precursor 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018047
Product type: DNA & cDNA
Ncbi symbol: TAC1
Origin species: Human
Product name: TAC1-tachykinin, precursor 1 Gene
Size: 2ug
Accessions: BC018047
Gene id: 6863
Gene description: tachykinin, precursor 1
Synonyms: Hs.2563; NK2; NKNA; NPK; TAC2; protachykinin-1; PPT; neurokinin 1; neurokinin 2; neurokinin A; neurokinin alpha; neuromedin L; neuropeptide K; neuropeptide gamma; preprotachykinin; protachykinin; substance K; tachykinin 2; tachykinin, precursor 1 (substance K, substance P, neurokinin 1, neurokinin 2, neuromedin L, neurokinin alpha, neuropeptide K, neuropeptide gamma); tachykinin precursor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaaatcctcgtggccttggcagtcttttttcttgtctccactcagctgtttgcagaagaaataggagccaatgatgatctgaattactggtccgactggtacgacagcgaccagatcaaggaggaactgccggagccctttgagcatcttctgcagagaatcgcccggagacccaagcctcagcagttctttggattaatgggcaaacgggatgctgattcctcaattgaaaaacaagtggccctgttaaaggctctttatggacatggccagatctctcacaaaagacataaaacagattcctttgttggactaatgggcaaaagagctttaaattctgtggcttatgaaaggagtgcaatgcagaattatgaaagaagacgttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ring finger protein 24
- zinc finger protein 44
- male-enhanced antigen 1
- dihydrofolate reductase

Buy TAC1-tachykinin, precursor 1 Gene now

Add to cart