SUB1-SUB1 homolog (S. cerevisiae) Gene View larger

SUB1-SUB1 homolog (S. cerevisiae) Gene

PTXBC010537

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SUB1-SUB1 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SUB1-SUB1 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010537
Product type: DNA & cDNA
Ncbi symbol: SUB1
Origin species: Human
Product name: SUB1-SUB1 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC010537
Gene id: 10923
Gene description: SUB1 homolog (S. cerevisiae)
Synonyms: SUB1 homolog, transcriptional regulator; SUB1 homolog; P15; PC4; p14; activated RNA polymerase II transcriptional coactivator p15; activated RNA polymerase II transcription cofactor 4; positive cofactor 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctaaatcaaaggaacttgtttcttcaagctcttctggcagtgattctgacagtgaggttgacaaaaagttaaagaggaaaaagcaagttgctccagaaaaacctgtaaagaaacaaaagacaggtgagacttcgagagccctgtcatcttctaaacagagcagcagcagcagagatgataacatgtttcagattgggaaaatgaggtacgttagtgttcgcgattttaaaggcaaagtgctaattgatattagagaatattggatggatcctgaaggtgaaatgaaaccaggaagaaaaggtatttctttaaatccagaacaatggagccagctgaaggaacagatttctgacattgatgatgcagtaagaaaactgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 159
- centrosomal protein 290kDa
- histone cluster 1, H2bn
- methyltransferase like 10

Buy SUB1-SUB1 homolog (S. cerevisiae) Gene now

Add to cart