HIST1H2BK-histone cluster 1, H2bk Gene View larger

HIST1H2BK-histone cluster 1, H2bk Gene

PTXBC000893

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HIST1H2BK-histone cluster 1, H2bk Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HIST1H2BK-histone cluster 1, H2bk Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000893
Product type: DNA & cDNA
Ncbi symbol: HIST1H2BK
Origin species: Human
Product name: HIST1H2BK-histone cluster 1, H2bk Gene
Size: 2ug
Accessions: BC000893
Gene id: 85236
Gene description: histone cluster 1, H2bk
Synonyms: H2B/S; H2BFAiii; H2BFT; H2BK; histone H2B type 1-K; H2B K; H2B histone family, member T; HIRA-interacting protein 1; histone 1, H2bk; histone cluster 1, H2bk; histone family member; histone cluster 1 H2B family member k
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccggaaccagcgaagtccgctcccgcgcccaagaagggctcgaagaaagccgtgactaaggcgcagaagaaggacggcaagaagcgcaagcgcagccgcaaggagagctactccgtatacgtgtacaaggtgctgaagcaggtccaccccgacaccggcatctcctctaaggccatgggaatcatgaactccttcgtcaacgacatcttcgaacgcatcgcgggtgaggcttcccgcctggcgcattacaacaagcgctcgaccatcacctccagggagatccagacggccgtgcgcctgctgctgcccggggagttggccaagcacgccgtgtccgagggcaccaaggccgtcaccaagtacaccagcgctaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SUB1 homolog (S. cerevisiae)
- transmembrane protein 159
- centrosomal protein 290kDa
- histone cluster 1, H2bn

Buy HIST1H2BK-histone cluster 1, H2bk Gene now

Add to cart