Login to display prices
Login to display prices
SF3B14-splicing factor 3B, 14 kDa subunit Gene View larger

SF3B14-splicing factor 3B, 14 kDa subunit Gene

PTXBC015463

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SF3B14-splicing factor 3B, 14 kDa subunit Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SF3B14-splicing factor 3B, 14 kDa subunit Gene

Proteogenix catalog: PTXBC015463
Ncbi symbol: SF3B14
Product name: SF3B14-splicing factor 3B, 14 kDa subunit Gene
Size: 2ug
Accessions: BC015463
Gene id: 51639
Gene description: splicing factor 3B, 14 kDa subunit
Synonyms: SF3B14; CGI-110; HSPC175; Ht006; P14; SAP14; SAP14a; SF3B14a; splicing factor 3B subunit 6; SF3b 14 kDa subunit; pre-mRNA branch site protein p14; spliceosome-associated protein, 14 kDa subunit; spliceosome-associated protein, 14-kDa; splicing factor 3B, 14 kDa subunit; splicing factor 3b, subunit 6, 14kDa
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgatgcaagcggccaagagggcgaacattcgacttccacctgaagtaaatcggatattgtatataagaaatttgccatacaaaatcacagctgaagaaatgtatgatatatttgggaaatatggacctattcgtcaaatcagagtggggaacacacctgaaactagaggaacagcttatgtggtctatgaggacatctttgatgccaagaatgcatgtgatcacctatcgggattcaatgtttgtaacagataccttgtggttttgtactataatgccaacagggcatttcagaagatggacacaaagaagaaggaggaacagttgaagcttctcaaggagaaatatggcatcaacacagatccaccaaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: