Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of SF3B14-splicing factor 3B, 14 kDa subunit Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SF3B14-splicing factor 3B, 14 kDa subunit Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015463 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SF3B14 |
| Origin species: | Human |
| Product name: | SF3B14-splicing factor 3B, 14 kDa subunit Gene |
| Size: | 2ug |
| Accessions: | BC015463 |
| Gene id: | 51639 |
| Gene description: | splicing factor 3B, 14 kDa subunit |
| Synonyms: | SF3B14; CGI-110; HSPC175; Ht006; P14; SAP14; SAP14a; SF3B14a; splicing factor 3B subunit 6; SF3b 14 kDa subunit; pre-mRNA branch site protein p14; spliceosome-associated protein, 14 kDa subunit; spliceosome-associated protein, 14-kDa; splicing factor 3B, 14 kDa subunit; splicing factor 3b, subunit 6, 14kDa |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgatgcaagcggccaagagggcgaacattcgacttccacctgaagtaaatcggatattgtatataagaaatttgccatacaaaatcacagctgaagaaatgtatgatatatttgggaaatatggacctattcgtcaaatcagagtggggaacacacctgaaactagaggaacagcttatgtggtctatgaggacatctttgatgccaagaatgcatgtgatcacctatcgggattcaatgtttgtaacagataccttgtggttttgtactataatgccaacagggcatttcagaagatggacacaaagaagaaggaggaacagttgaagcttctcaaggagaaatatggcatcaacacagatccaccaaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - LIM domain only 3 (rhombotin-like 2) - coiled-coil domain containing 28A - BCL2-associated agonist of cell death - keratin associated protein 4-12 |