EDEM3-ER degradation enhancer, mannosidase alpha-like 3 Gene View larger

EDEM3-ER degradation enhancer, mannosidase alpha-like 3 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EDEM3-ER degradation enhancer, mannosidase alpha-like 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about EDEM3-ER degradation enhancer, mannosidase alpha-like 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016464
Product type: DNA & cDNA
Ncbi symbol: EDEM3
Origin species: Human
Product name: EDEM3-ER degradation enhancer, mannosidase alpha-like 3 Gene
Size: 2ug
Accessions: BC016464
Gene id: 80267
Gene description: ER degradation enhancer, mannosidase alpha-like 3
Synonyms: alpha-1,2-mannosidase EDEM3; C1orf22; ER degradation-enhancing alpha-mannosidase-like protein 3; ER degradation enhancer, mannosidase alpha-like 3; ER degradation-enhancing -mannosidase-like protein 3; ER degradation-enhancing alpha-mannosidase-like 3; ER degradation enhancing alpha-mannosidase like protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaggctttaagtatggtgatgaacaaccacgttctgactggcgtagttatcgtaggaatctggagcatgctgtgttagaattgaccttgtttaaaactgtcccatcaaaaatggaaatccacagttcccccttcaaatgcagcactgcaccaccctgcaacacctcaggccagggaaagattactgagcattcctgcgaaccagatttctgttgtctctggatagacaagaaacaaaattcatttagtagtggagtggggaataggagtttggatagccttctaattaaaggaagctcgcctttcttggttttgggggttagaggctcttttgggaagatgcatccgagtattgtggcattctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cyclin-dependent kinase inhibitor 1A (p21, Cip1)
- FUS interacting protein (serine/arginine-rich) 1
- cyclin-dependent kinase inhibitor 1B (p27, Kip1)
- heterogeneous nuclear ribonucleoprotein A2/B1

Buy EDEM3-ER degradation enhancer, mannosidase alpha-like 3 Gene now

Add to cart