Login to display prices
Login to display prices
EDEM3-ER degradation enhancer, mannosidase alpha-like 3 Gene View larger

EDEM3-ER degradation enhancer, mannosidase alpha-like 3 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EDEM3-ER degradation enhancer, mannosidase alpha-like 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about EDEM3-ER degradation enhancer, mannosidase alpha-like 3 Gene

Proteogenix catalog: PTXBC016464
Ncbi symbol: EDEM3
Product name: EDEM3-ER degradation enhancer, mannosidase alpha-like 3 Gene
Size: 2ug
Accessions: BC016464
Gene id: 80267
Gene description: ER degradation enhancer, mannosidase alpha-like 3
Synonyms: alpha-1,2-mannosidase EDEM3; C1orf22; ER degradation-enhancing alpha-mannosidase-like protein 3; ER degradation enhancer, mannosidase alpha-like 3; ER degradation-enhancing -mannosidase-like protein 3; ER degradation-enhancing alpha-mannosidase-like 3; ER degradation enhancing alpha-mannosidase like protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaggctttaagtatggtgatgaacaaccacgttctgactggcgtagttatcgtaggaatctggagcatgctgtgttagaattgaccttgtttaaaactgtcccatcaaaaatggaaatccacagttcccccttcaaatgcagcactgcaccaccctgcaacacctcaggccagggaaagattactgagcattcctgcgaaccagatttctgttgtctctggatagacaagaaacaaaattcatttagtagtggagtggggaataggagtttggatagccttctaattaaaggaagctcgcctttcttggttttgggggttagaggctcttttgggaagatgcatccgagtattgtggcattctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: