Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
EDEM3-ER degradation enhancer, mannosidase alpha-like 3 Gene
PTXBC016464
New product
Data sheet of EDEM3-ER degradation enhancer, mannosidase alpha-like 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EDEM3-ER degradation enhancer, mannosidase alpha-like 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016464 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EDEM3 |
| Origin species: | Human |
| Product name: | EDEM3-ER degradation enhancer, mannosidase alpha-like 3 Gene |
| Size: | 2ug |
| Accessions: | BC016464 |
| Gene id: | 80267 |
| Gene description: | ER degradation enhancer, mannosidase alpha-like 3 |
| Synonyms: | alpha-1,2-mannosidase EDEM3; C1orf22; ER degradation-enhancing alpha-mannosidase-like protein 3; ER degradation enhancer, mannosidase alpha-like 3; ER degradation-enhancing -mannosidase-like protein 3; ER degradation-enhancing alpha-mannosidase-like 3; ER degradation enhancing alpha-mannosidase like protein 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggaggctttaagtatggtgatgaacaaccacgttctgactggcgtagttatcgtaggaatctggagcatgctgtgttagaattgaccttgtttaaaactgtcccatcaaaaatggaaatccacagttcccccttcaaatgcagcactgcaccaccctgcaacacctcaggccagggaaagattactgagcattcctgcgaaccagatttctgttgtctctggatagacaagaaacaaaattcatttagtagtggagtggggaataggagtttggatagccttctaattaaaggaagctcgcctttcttggttttgggggttagaggctcttttgggaagatgcatccgagtattgtggcattctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cyclin-dependent kinase inhibitor 1A (p21, Cip1) - FUS interacting protein (serine/arginine-rich) 1 - cyclin-dependent kinase inhibitor 1B (p27, Kip1) - heterogeneous nuclear ribonucleoprotein A2/B1 |