Login to display prices
Login to display prices
LYRM1-LYR motif containing 1 Gene View larger

LYRM1-LYR motif containing 1 Gene

PTXBC017039

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LYRM1-LYR motif containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LYRM1-LYR motif containing 1 Gene

Proteogenix catalog: PTXBC017039
Ncbi symbol: LYRM1
Product name: LYRM1-LYR motif containing 1 Gene
Size: 2ug
Accessions: BC017039
Gene id: 57149
Gene description: LYR motif containing 1
Synonyms: A211C6.1; LYR motif-containing protein 1; LYR motif containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacaacggcaacacgacaagaagtccttggcctctaccgcagcattttcaggcttgcgaggaaatggcaggcgacatcagggcagatggaagacaccatcaaagaaaaacagtacatactaaatgaagccagaacgctgttccggaaaaacaaaaatctcacggacacagacctaattaaacagtgtatagatgaatgcacagccaggattgaaattggactgcattacaagattccttacccaaggccaattcatctgcctccaatgggccttaccccactccgaggccggggacttcgaagccaagagaaactgaggaaactttccaaaccagtatatctcagatctcatgatgaagtttcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: