Login to display prices
Login to display prices
ENSA-endosulfine alpha Gene View larger

ENSA-endosulfine alpha Gene

PTXBC000436

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ENSA-endosulfine alpha Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ENSA-endosulfine alpha Gene

Proteogenix catalog: PTXBC000436
Ncbi symbol: ENSA
Product name: ENSA-endosulfine alpha Gene
Size: 2ug
Accessions: BC000436
Gene id: 2029
Gene description: endosulfine alpha
Synonyms: ARPP-19e; alpha-endosulfine; endosulfine-alpha variant 1; endosulfine-alpha variant 3; endosulfine alpha
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcccagaaacaagaagaagagaaccctgcggaggagaccggcgaggagaagcaggacacgcaggagaaagaaggtattctgcctgagagagctgaagaggcaaagctaaaggccaaatacccaagcctaggacaaaagcctggaggctccgacttcctcatgaagagactccagaaagggcaaaagtactttgactcaggagactacaacatggccaaagccaagatgaagaataagcagctgccaagtgcaggaccagacaagaacctggtgactggtgatcacatccccaccccacaggatctgccccagagaaagtcctcgctcgtcaccagcaagcttgcgggtggccaagttgaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: