PTXBC018206
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC018206 |
Product type: | DNA & cDNA |
Ncbi symbol: | FAM128A |
Origin species: | Human |
Product name: | FAM128A-family with sequence similarity 128, member A Gene |
Size: | 2ug |
Accessions: | BC018206 |
Gene id: | 653784 |
Gene description: | family with sequence similarity 128, member A |
Synonyms: | FAM128A; MOZART2A; mitotic-spindle organizing protein 2A; family with sequence similarity 128, member A; mitotic-spindle organizing protein associated with a ring of gamma-tubulin 2A; mitotic spindle organizing protein 2A |
Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
Orf sequence: | atggagctgtacgagctggctcaggcggcgggcggcggtatcgaccccgacgtgttcaagatcctggtggacctgctgaagctgaacgtggcccccctcgccgtcttccagatgctcaagtccatgtgtgccgggcagaggctagcgagcgagccccaggaccctgcggccgtgtctctgcccacgtcgagcgtgcccgagacccgagggagagacaaaggcagcgctgccctcgggggagtattggccctggcggaacgcagcaaccacgagggatccagccagaggatgccacgccagcccagcgctaccaggctgcccaaggggggcgggcctgggaagagccctacgcagggcagcacctag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20℃ |
Delivery condition: | Blue Ice |
Related products: | - family with sequence similarity 107, member A - growth arrest and DNA-damage-inducible, gamma - ADP-ribosylation factor-like 2 binding protein - family with sequence similarity 158, member A |