FAM128A-family with sequence similarity 128, member A Gene View larger

FAM128A-family with sequence similarity 128, member A Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM128A-family with sequence similarity 128, member A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAM128A-family with sequence similarity 128, member A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018206
Product type: DNA & cDNA
Ncbi symbol: FAM128A
Origin species: Human
Product name: FAM128A-family with sequence similarity 128, member A Gene
Size: 2ug
Accessions: BC018206
Gene id: 653784
Gene description: family with sequence similarity 128, member A
Synonyms: FAM128A; MOZART2A; mitotic-spindle organizing protein 2A; family with sequence similarity 128, member A; mitotic-spindle organizing protein associated with a ring of gamma-tubulin 2A; mitotic spindle organizing protein 2A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagctgtacgagctggctcaggcggcgggcggcggtatcgaccccgacgtgttcaagatcctggtggacctgctgaagctgaacgtggcccccctcgccgtcttccagatgctcaagtccatgtgtgccgggcagaggctagcgagcgagccccaggaccctgcggccgtgtctctgcccacgtcgagcgtgcccgagacccgagggagagacaaaggcagcgctgccctcgggggagtattggccctggcggaacgcagcaaccacgagggatccagccagaggatgccacgccagcccagcgctaccaggctgcccaaggggggcgggcctgggaagagccctacgcagggcagcacctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 107, member A
- growth arrest and DNA-damage-inducible, gamma
- ADP-ribosylation factor-like 2 binding protein
- family with sequence similarity 158, member A

Buy FAM128A-family with sequence similarity 128, member A Gene now

Add to cart