No products
Prices are tax excluded
PTXBC018206
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018206 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FAM128A |
| Origin species: | Human |
| Product name: | FAM128A-family with sequence similarity 128, member A Gene |
| Size: | 2ug |
| Accessions: | BC018206 |
| Gene id: | 653784 |
| Gene description: | family with sequence similarity 128, member A |
| Synonyms: | FAM128A; MOZART2A; mitotic-spindle organizing protein 2A; family with sequence similarity 128, member A; mitotic-spindle organizing protein associated with a ring of gamma-tubulin 2A; mitotic spindle organizing protein 2A |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagctgtacgagctggctcaggcggcgggcggcggtatcgaccccgacgtgttcaagatcctggtggacctgctgaagctgaacgtggcccccctcgccgtcttccagatgctcaagtccatgtgtgccgggcagaggctagcgagcgagccccaggaccctgcggccgtgtctctgcccacgtcgagcgtgcccgagacccgagggagagacaaaggcagcgctgccctcgggggagtattggccctggcggaacgcagcaaccacgagggatccagccagaggatgccacgccagcccagcgctaccaggctgcccaaggggggcgggcctgggaagagccctacgcagggcagcacctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 107, member A - growth arrest and DNA-damage-inducible, gamma - ADP-ribosylation factor-like 2 binding protein - family with sequence similarity 158, member A |