SNX22-sorting nexin 22 Gene View larger

SNX22-sorting nexin 22 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SNX22-sorting nexin 22 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SNX22-sorting nexin 22 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019655
Product type: DNA & cDNA
Ncbi symbol: SNX22
Origin species: Human
Product name: SNX22-sorting nexin 22 Gene
Size: 2ug
Accessions: BC019655
Gene id: 79856
Gene description: sorting nexin 22
Synonyms: sorting nexin-22; sorting nexin 22
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctggaagttcacatcccgtcggtggggcccgaggccgaggggcccaggcagagcccggagaaaagccacatggtgttccgagtggaggtgctgtgcagcgggcgcagacacacggtgccaaggcgctacagcgagttccacgcgctgcacaagcggatcaagaagctgtacaaagtgcccgacttcccctcgaaacgcctgcccaactggaggaccagagggttggaacagcgccggcagggcttggaggcttacatccagggcatcctgtacctgaaccaggaggtgcccaaggagttactggaattcctgagacttcggcacttccccacagaccccaaggctagcaactgggggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - endosulfine alpha
- dynactin 3 (p22)
- adenylate kinase 1
- phosducin-like 2

Buy SNX22-sorting nexin 22 Gene now

Add to cart