MGC42157-hypothetical locus MGC42157 Gene View larger

MGC42157-hypothetical locus MGC42157 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGC42157-hypothetical locus MGC42157 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MGC42157-hypothetical locus MGC42157 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030111
Product type: DNA & cDNA
Ncbi symbol: MGC42157
Origin species: Human
Product name: MGC42157-hypothetical locus MGC42157 Gene
Size: 2ug
Accessions: BC030111
Gene id: 439933
Gene description: hypothetical locus MGC42157
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagaaggctaaactttttcttcccacatgctcacttcctcgcttgttcgctagctgctgcatctggcccctcaagggtaaagtcaaggggaaaaggagattgagaggaaggacagtctgtgaattgggtctcaccgtgtttcccaggctgaagtacagtgttgtgatatcagttcattgcaacttctgtcttctgagctcaagcaatcctcttgcctcagcctctcaagtagctgggactgactacaggcatgaaccaccacacctggctaattttttttgtatttttgtcgaaaagacagtttcgccatgttgtacagaactacttctcaaatcactattcacatcctggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - FK506 binding protein 2, 13kDa
- superoxide dismutase 1, soluble
- gamma-glutamyl cyclotransferase
- dicarbonyl/L-xylulose reductase

Buy MGC42157-hypothetical locus MGC42157 Gene now

Add to cart