Login to display prices
Login to display prices
MGC42157-hypothetical locus MGC42157 Gene View larger

MGC42157-hypothetical locus MGC42157 Gene

PTXBC030111

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGC42157-hypothetical locus MGC42157 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MGC42157-hypothetical locus MGC42157 Gene

Proteogenix catalog: PTXBC030111
Ncbi symbol: MGC42157
Product name: MGC42157-hypothetical locus MGC42157 Gene
Size: 2ug
Accessions: BC030111
Gene id: 439933
Gene description: hypothetical locus MGC42157
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagaaggctaaactttttcttcccacatgctcacttcctcgcttgttcgctagctgctgcatctggcccctcaagggtaaagtcaaggggaaaaggagattgagaggaaggacagtctgtgaattgggtctcaccgtgtttcccaggctgaagtacagtgttgtgatatcagttcattgcaacttctgtcttctgagctcaagcaatcctcttgcctcagcctctcaagtagctgggactgactacaggcatgaaccaccacacctggctaattttttttgtatttttgtcgaaaagacagtttcgccatgttgtacagaactacttctcaaatcactattcacatcctggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: