DCXR-dicarbonyl/L-xylulose reductase Gene View larger

DCXR-dicarbonyl/L-xylulose reductase Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DCXR-dicarbonyl/L-xylulose reductase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DCXR-dicarbonyl/L-xylulose reductase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001470
Product type: DNA & cDNA
Ncbi symbol: DCXR
Origin species: Human
Product name: DCXR-dicarbonyl/L-xylulose reductase Gene
Size: 2ug
Accessions: BC001470
Gene id: 51181
Gene description: dicarbonyl/L-xylulose reductase
Synonyms: DCR; HCR2; HCRII; KIDCR; P34H; PNTSU; SDR20C1; L-xylulose reductase; carbonyl reductase 2; carbonyl reductase II; dicarbonyl/L-xylulose reductase; kidney dicarbonyl reductase; short chain dehydrogenase/reductase family 20C member 1; sperm surface protein P34H; dicarbonyl and L-xylulose reductase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagctgttcctcgcgggccgccgggtgctggtcaccggggcaggcaaaggtatagggcgcggcacggtccaggcgctgcacgcgacgggcgcgcgggtggtggctgtgagccggactcaggcggatcttgacagccttgtccgcgagtgcccggggatagaacccgtgtgcgtggacctgggtgactgggaggccaccgagcgggcgctgggcagcgtgggccccgtggacctgctggtgaacaacgccgctgtcgccctgctgcagcccttcctggaggtcaccaaggaggcctttgacagatcctttgaggtgaacctgcgtgcggtcatccaggtgtcgcagattgtggccaggggcttaatagcccggggagtcccaggggccatcgtgaatgtctccagccagtgctcccagcgggcagtaactaaccatagcgtctactgctccaccaagggtgccctggacatgctgaccaaggtgatggccctagagctcgggccccacaagatccgagtgaatgcagtaaaccccacagtggtgatgacgtccatgggccaggccacctggagtgacccccacaaggccaagactatgctgaaccgaatcccacttggcaagtttgctgaggtagagcacgtggtgaacgccatcctctttctgctgagtgaccgaagtggcatgaccacgggttccactttgccggtggaagggggcttctgggcctgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein S4, X-linked
- 5'-nucleotidase, cytosolic III
- glyoxalase domain containing 4
- sprouty homolog 2 (Drosophila)

Buy DCXR-dicarbonyl/L-xylulose reductase Gene now

Add to cart