Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 749,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 749,00 €
Data sheet of DCXR-dicarbonyl/L-xylulose reductase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DCXR-dicarbonyl/L-xylulose reductase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001470 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DCXR |
| Origin species: | Human |
| Product name: | DCXR-dicarbonyl/L-xylulose reductase Gene |
| Size: | 2ug |
| Accessions: | BC001470 |
| Gene id: | 51181 |
| Gene description: | dicarbonyl/L-xylulose reductase |
| Synonyms: | DCR; HCR2; HCRII; KIDCR; P34H; PNTSU; SDR20C1; L-xylulose reductase; carbonyl reductase 2; carbonyl reductase II; dicarbonyl/L-xylulose reductase; kidney dicarbonyl reductase; short chain dehydrogenase/reductase family 20C member 1; sperm surface protein P34H; dicarbonyl and L-xylulose reductase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagctgttcctcgcgggccgccgggtgctggtcaccggggcaggcaaaggtatagggcgcggcacggtccaggcgctgcacgcgacgggcgcgcgggtggtggctgtgagccggactcaggcggatcttgacagccttgtccgcgagtgcccggggatagaacccgtgtgcgtggacctgggtgactgggaggccaccgagcgggcgctgggcagcgtgggccccgtggacctgctggtgaacaacgccgctgtcgccctgctgcagcccttcctggaggtcaccaaggaggcctttgacagatcctttgaggtgaacctgcgtgcggtcatccaggtgtcgcagattgtggccaggggcttaatagcccggggagtcccaggggccatcgtgaatgtctccagccagtgctcccagcgggcagtaactaaccatagcgtctactgctccaccaagggtgccctggacatgctgaccaaggtgatggccctagagctcgggccccacaagatccgagtgaatgcagtaaaccccacagtggtgatgacgtccatgggccaggccacctggagtgacccccacaaggccaagactatgctgaaccgaatcccacttggcaagtttgctgaggtagagcacgtggtgaacgccatcctctttctgctgagtgaccgaagtggcatgaccacgggttccactttgccggtggaagggggcttctgggcctgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ribosomal protein S4, X-linked - 5'-nucleotidase, cytosolic III - glyoxalase domain containing 4 - sprouty homolog 2 (Drosophila) |