Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of SOD1-superoxide dismutase 1, soluble Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SOD1-superoxide dismutase 1, soluble Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001034 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SOD1 |
| Origin species: | Human |
| Product name: | SOD1-superoxide dismutase 1, soluble Gene |
| Size: | 2ug |
| Accessions: | BC001034 |
| Gene id: | 6647 |
| Gene description: | superoxide dismutase 1, soluble |
| Synonyms: | ALS; ALS1; HEL-S-44; IPOA; SOD; hSod1; homodimer; superoxide dismutase [Cu-Zn]; Cu/Zn superoxide dismutase; SOD, soluble; epididymis secretory protein Li 44; indophenoloxidase A; superoxide dismutase, cystolic; superoxide dismutase 1, soluble |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgacgaaggccgtgtgcgtgctgaagggcgacggcccagtgcagggcatcatcaatttcgagcagaaggaaagtaatggaccagtgaaggtgtggggaagcattaaaggactgactgaaggcctgcatggattccatgttcatgagtttggagataatacagcaggctgtaccagtgcaggtcctcactttaatcctctatccagaaaacacggtgggccaaaggatgaagagaggcatgttggagacttgggcaatgtgactgctgacaaagatggtgtggccgatgtgtctattgaagattctgtgatctcactctcaggagaccattgcatcattggccgcacactggtggtccatgaaaaagcagatgacttgggcaaaggtggaaatgaagaaagtacaaagacaggaaacgctggaagtcgtttggcttgtggtgtaattgggatcgcccaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - gamma-glutamyl cyclotransferase - dicarbonyl/L-xylulose reductase - ribosomal protein S4, X-linked - 5'-nucleotidase, cytosolic III |