SOD1-superoxide dismutase 1, soluble Gene View larger

SOD1-superoxide dismutase 1, soluble Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SOD1-superoxide dismutase 1, soluble Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SOD1-superoxide dismutase 1, soluble Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001034
Product type: DNA & cDNA
Ncbi symbol: SOD1
Origin species: Human
Product name: SOD1-superoxide dismutase 1, soluble Gene
Size: 2ug
Accessions: BC001034
Gene id: 6647
Gene description: superoxide dismutase 1, soluble
Synonyms: ALS; ALS1; HEL-S-44; IPOA; SOD; hSod1; homodimer; superoxide dismutase [Cu-Zn]; Cu/Zn superoxide dismutase; SOD, soluble; epididymis secretory protein Li 44; indophenoloxidase A; superoxide dismutase, cystolic; superoxide dismutase 1, soluble
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgacgaaggccgtgtgcgtgctgaagggcgacggcccagtgcagggcatcatcaatttcgagcagaaggaaagtaatggaccagtgaaggtgtggggaagcattaaaggactgactgaaggcctgcatggattccatgttcatgagtttggagataatacagcaggctgtaccagtgcaggtcctcactttaatcctctatccagaaaacacggtgggccaaaggatgaagagaggcatgttggagacttgggcaatgtgactgctgacaaagatggtgtggccgatgtgtctattgaagattctgtgatctcactctcaggagaccattgcatcattggccgcacactggtggtccatgaaaaagcagatgacttgggcaaaggtggaaatgaagaaagtacaaagacaggaaacgctggaagtcgtttggcttgtggtgtaattgggatcgcccaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - gamma-glutamyl cyclotransferase
- dicarbonyl/L-xylulose reductase
- ribosomal protein S4, X-linked
- 5'-nucleotidase, cytosolic III

Buy SOD1-superoxide dismutase 1, soluble Gene now

Add to cart