Login to display prices
Login to display prices
SOD1-superoxide dismutase 1, soluble Gene View larger

SOD1-superoxide dismutase 1, soluble Gene

PTXBC001034

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SOD1-superoxide dismutase 1, soluble Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SOD1-superoxide dismutase 1, soluble Gene

Proteogenix catalog: PTXBC001034
Ncbi symbol: SOD1
Product name: SOD1-superoxide dismutase 1, soluble Gene
Size: 2ug
Accessions: BC001034
Gene id: 6647
Gene description: superoxide dismutase 1, soluble
Synonyms: ALS; ALS1; HEL-S-44; IPOA; SOD; hSod1; homodimer; superoxide dismutase [Cu-Zn]; Cu/Zn superoxide dismutase; SOD, soluble; epididymis secretory protein Li 44; indophenoloxidase A; superoxide dismutase, cystolic; superoxide dismutase 1, soluble
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgacgaaggccgtgtgcgtgctgaagggcgacggcccagtgcagggcatcatcaatttcgagcagaaggaaagtaatggaccagtgaaggtgtggggaagcattaaaggactgactgaaggcctgcatggattccatgttcatgagtttggagataatacagcaggctgtaccagtgcaggtcctcactttaatcctctatccagaaaacacggtgggccaaaggatgaagagaggcatgttggagacttgggcaatgtgactgctgacaaagatggtgtggccgatgtgtctattgaagattctgtgatctcactctcaggagaccattgcatcattggccgcacactggtggtccatgaaaaagcagatgacttgggcaaaggtggaaatgaagaaagtacaaagacaggaaacgctggaagtcgtttggcttgtggtgtaattgggatcgcccaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: