Login to display prices
Login to display prices
GGCT-gamma-glutamyl cyclotransferase Gene View larger

GGCT-gamma-glutamyl cyclotransferase Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GGCT-gamma-glutamyl cyclotransferase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GGCT-gamma-glutamyl cyclotransferase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000625
Product type: DNA & cDNA
Ncbi symbol: GGCT
Origin species: Human
Product name: GGCT-gamma-glutamyl cyclotransferase Gene
Size: 2ug
Accessions: BC000625
Gene id: 79017
Gene description: gamma-glutamyl cyclotransferase
Synonyms: C7orf24; CRF21; GCTG; GGC; gamma-glutamylcyclotransferase; cytochrome c-releasing factor 21; gamma -glutamyl cyclotransferase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccaactcgggctgcaaggacgtcacgggtccagatgaggagagttttctgtactttgcctacggcagcaacctgctgacagagaggatccacctccgaaacccctcggcggcgttcttctgtgtggcccgcctgcaggattttaagcttgactttggcaattcccaaggcaaaacaagtcaaacttggcatggagggatagccaccatttttcagagtcctggcgatgaagtgtggggagtagtatggaaaatgaacaaaagcaatttaaattctctggatgagcaagaaggggttaaaagtggaatgtatgttgtaatagaagttaaagttgcaactcaagaaggaaaagaaataacctgtcgaagttatctgatgacaaattacgaaagtgctcccccatccccacagtataaaaagattatttgcatgggtgcaaaagaaaatggtttgccgctggagtatcaagagaagttaaaagcaatagaaccaaatgactatacaggaaaggtctcagaagaaattgaagacatcatcaaaaagggggaaacacaaactctttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - dicarbonyl/L-xylulose reductase
- ribosomal protein S4, X-linked
- 5'-nucleotidase, cytosolic III
- glyoxalase domain containing 4