Login to display prices
Login to display prices
FKBP2-FK506 binding protein 2, 13kDa Gene View larger

FKBP2-FK506 binding protein 2, 13kDa Gene

PTXBC003384

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FKBP2-FK506 binding protein 2, 13kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FKBP2-FK506 binding protein 2, 13kDa Gene

Proteogenix catalog: PTXBC003384
Ncbi symbol: FKBP2
Product name: FKBP2-FK506 binding protein 2, 13kDa Gene
Size: 2ug
Accessions: BC003384
Gene id: 2286
Gene description: FK506 binding protein 2, 13kDa
Synonyms: PPIase FKBP2; peptidyl-prolyl cis-trans isomerase FKBP2; FKBP-13; PPIase; 13 kDa FK506-binding protein; 13 kDa FKBP; FK506 binding protein 2, 13kDa; FKBP-2; immunophilin FKBP13; proline isomerase; rapamycin-binding protein; rotamase; FK506 binding protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggctgagctggttccgggtcctgacagtactgtccatctgcctgagcgccgtggccacggccacgggggccgagggcaaaaggaagctgcagatcggggtcaagaagcgggtggaccactgtcccatcaaatcgcgcaaaggggatgtcctgcacatgcactacacggggaagctggaagatgggacagagtttgacagcagcctgccccagaaccagccctttgtcttctcccttggcacaggccaggtcatcaagggctgggaccaggggctgctggggatgtgtgagggggaaaagcgcaagctggtgatcccatccgagctagggtatggagagcggggagctcccccaaagattccaggcggtgcaaccctggtgttcgaggtggagctgctcaaaatagagcgacgaactgagctgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: