Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of FKBP2-FK506 binding protein 2, 13kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FKBP2-FK506 binding protein 2, 13kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003384 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FKBP2 |
| Origin species: | Human |
| Product name: | FKBP2-FK506 binding protein 2, 13kDa Gene |
| Size: | 2ug |
| Accessions: | BC003384 |
| Gene id: | 2286 |
| Gene description: | FK506 binding protein 2, 13kDa |
| Synonyms: | PPIase FKBP2; peptidyl-prolyl cis-trans isomerase FKBP2; FKBP-13; PPIase; 13 kDa FK506-binding protein; 13 kDa FKBP; FK506 binding protein 2, 13kDa; FKBP-2; immunophilin FKBP13; proline isomerase; rapamycin-binding protein; rotamase; FK506 binding protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaggctgagctggttccgggtcctgacagtactgtccatctgcctgagcgccgtggccacggccacgggggccgagggcaaaaggaagctgcagatcggggtcaagaagcgggtggaccactgtcccatcaaatcgcgcaaaggggatgtcctgcacatgcactacacggggaagctggaagatgggacagagtttgacagcagcctgccccagaaccagccctttgtcttctcccttggcacaggccaggtcatcaagggctgggaccaggggctgctggggatgtgtgagggggaaaagcgcaagctggtgatcccatccgagctagggtatggagagcggggagctcccccaaagattccaggcggtgcaaccctggtgttcgaggtggagctgctcaaaatagagcgacgaactgagctgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - superoxide dismutase 1, soluble - gamma-glutamyl cyclotransferase - dicarbonyl/L-xylulose reductase - ribosomal protein S4, X-linked |