GHRL-ghrelin/obestatin prepropeptide Gene View larger

GHRL-ghrelin/obestatin prepropeptide Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GHRL-ghrelin/obestatin prepropeptide Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GHRL-ghrelin/obestatin prepropeptide Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025791
Product type: DNA & cDNA
Ncbi symbol: GHRL
Origin species: Human
Product name: GHRL-ghrelin/obestatin prepropeptide Gene
Size: 2ug
Accessions: BC025791
Gene id: 51738
Gene description: ghrelin/obestatin prepropeptide
Synonyms: MTLRP; appetite-regulating hormone; In2c-preproghrelin; ghrelin, growth hormone secretagogue receptor ligand; ghrelin/obestatin preprohormone; ghrelin/obestatin prepropeptide; growth hormone-releasing peptide; motilin-related peptide; prepro-appetite regulatory hormone; preproghrelin; ghrelin and obestatin prepropeptide
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccctccccagggaccgtctgcagcctcctgctcctcggcatgctctggctggacttggccatggcaggctccagcttcctgagccctgaacaccagagagtccagcagagaaaggagtcgaagaagccaccagccaagctgcagccccgagctctagcaggctggctccgcccggaagatggaggtcaagcagaaggggcagaggatgaaatggaagtccggttcaacgccccctttgatgttggaatcaagctgtcaggggttcagtaccagcagcacagccaggccctggggaagtttcttcaggacatcctctgggaagaggccaaagaggccccagccgacaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical locus MGC42157
- FK506 binding protein 2, 13kDa
- superoxide dismutase 1, soluble
- gamma-glutamyl cyclotransferase

Buy GHRL-ghrelin/obestatin prepropeptide Gene now

Add to cart