Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of ABAT-4-aminobutyrate aminotransferase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ABAT-4-aminobutyrate aminotransferase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008990 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ABAT |
| Origin species: | Human |
| Product name: | ABAT-4-aminobutyrate aminotransferase Gene |
| Size: | 2ug |
| Accessions: | BC008990 |
| Gene id: | 18 |
| Gene description: | 4-aminobutyrate aminotransferase |
| Synonyms: | GABA-AT; GABAT; NPD009; 4-aminobutyrate aminotransferase, mitochondrial; (S)-3-amino-2-methylpropionate transaminase; 4-aminobutyrate transaminase; GABA aminotransferase; GABA transaminase; GABA transferase; gamma-amino-N-butyrate transaminase; 4-aminobutyrate aminotransferase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagaaccaccattcacccaagggtcagaggaggtttcaaagaaaaggtgtcattggagcagtgttttgcagaatgagccagagttcaccaagcaggcaaggcaaggaagggtgttgcagagagggaacagcatatgcaaaggcatatcagttcatggcatcacatctttcactggggaagccagtttccacaggcagcatcccaaggttcaataaggccttatttaacaagcaagcaaaatgcaaaccaaaccattattcatttattggcttaagtatgctttctcctgaaaactttagcattgggtgcaaatattcagtatggttctcggagaccaaagggttttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - PYD and CARD domain containing - ubiquitin specific peptidase 47 - synovial sarcoma, X breakpoint 2 - ADP-ribosylation factor-like 4A |