TMEM14C-transmembrane protein 14C Gene View larger

TMEM14C-transmembrane protein 14C Gene

PTXBC002496

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM14C-transmembrane protein 14C Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM14C-transmembrane protein 14C Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002496
Product type: DNA & cDNA
Ncbi symbol: TMEM14C
Origin species: Human
Product name: TMEM14C-transmembrane protein 14C Gene
Size: 2ug
Accessions: BC002496
Gene id: 51522
Gene description: transmembrane protein 14C
Synonyms: C6orf53; HSPC194; MSTP073; NET26; bA421M1.6; transmembrane protein 14C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaggacactggctcagtagtgcctttgcattggtttggctttggctacgcagcactggttgcttctggtgggatcattggctatgtaaaagcaggcagcgtgccgtccctggctgcagggctgctctttggcagtctagccggcctgggtgcttaccagctgtctcaggatccaaggaacgtttgggttttcctagctacatctggtaccttggctggcattatgggaatgaggttctaccactctggaaaattcatgcctgcaggtttaattgcaggtgccagtttgctgatggtcgccaaagttggagttagtatgttcaacagaccccattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - histone cluster 1, H2bk
- SUB1 homolog (S. cerevisiae)
- transmembrane protein 159
- centrosomal protein 290kDa

Buy TMEM14C-transmembrane protein 14C Gene now

Add to cart