Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NDUFV3-NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa Gene
PTXBC033766
New product
Data sheet of NDUFV3-NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NDUFV3-NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033766 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NDUFV3 |
| Origin species: | Human |
| Product name: | NDUFV3-NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa Gene |
| Size: | 2ug |
| Accessions: | BC033766 |
| Gene id: | 4731 |
| Gene description: | NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa |
| Synonyms: | CI-10k; CI-9KD; NADH dehydrogenase [ubiquinone] flavoprotein 3, mitochondrial; NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa; NADH-ubiquinone oxidoreductase 9 kD subunit; NADH-ubiquinone oxidoreductase 9 kDa subunit; NADH-ubiquinone oxidoreductase flavoprotein 3, 10kD; complex I 10kDa subunit; complex I, mitochondrial respiratory chain, 10-kD subunit; complex I-9kD; mitochondrial NADH oxidoreductase-like protein; renal carcinoma antigen NY-REN-4; NADH:ubiquinone oxidoreductase subunit V3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgccccgtgtttgctgcggcaaggacgagccggggcgctgaagactatgctccaggaagcccaggtgtttcgaggacttgcttctacggtttctttgtctgcggaatcagggaagagtgaaaagggtcagccacagaattccaagaagcaaagtccaccaaaaaagccagccccagtgcctgctgagccgtttgacaacactacctacaagaacctgcagcatcatgactacagcacgtacaccttcttagacctcaacctcgaactctcaaaattcaggatgcctcagccctcctcaggccgggagtcacctcgacactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - recombination activating gene 1 activating protein 1 - tRNA splicing endonuclease 15 homolog (S. cerevisiae) - NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa - Fc fragment of IgG, low affinity IIa, receptor (CD32) |