CCL13-chemokine (C-C motif) ligand 13 Gene View larger

CCL13-chemokine (C-C motif) ligand 13 Gene

New product

920,68 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCL13-chemokine (C-C motif) ligand 13 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CCL13-chemokine (C-C motif) ligand 13 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008621
Product type: DNA & cDNA
Ncbi symbol: CCL13
Origin species: Human
Product name: CCL13-chemokine (C-C motif) ligand 13 Gene
Size: 2ug
Accessions: BC008621
Gene id: 6357
Gene description: chemokine (C-C motif) ligand 13
Synonyms: CKb10; MCP-4; NCC-1; NCC1; SCYA13; SCYL1; C-C motif chemokine 13; CK-beta-10; chemokine (C-C motif) ligand 13; monocyte chemoattractant protein 4; monocyte chemotactic protein 4; new CC chemokine 1; small inducible cytokine subfamily A (Cys-Cys), member 13; small-inducible cytokine A13; C-C motif chemokine ligand 13
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaagtctctgcagtgcttctgtgcctgctgctcatgacagcagctttcaacccccagggacttgctcagccagatgcactcaacgtcccatctacttgctgcttcacatttagcagtaagaagatctccttgcagaggctgaagagctatgtgatcaccaccagcaggtgtccccagaaggctgtcatcttcagaaccaaactgggcaaggagatctgtgctgacccaaaggagaagtgggtccagaattatatgaaacacctgggccggaaagctcacaccctgaagacttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - 4-aminobutyrate aminotransferase
- PYD and CARD domain containing
- ubiquitin specific peptidase 47
- synovial sarcoma, X breakpoint 2

Buy CCL13-chemokine (C-C motif) ligand 13 Gene now

Add to cart