Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CCL13-chemokine (C-C motif) ligand 13 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CCL13-chemokine (C-C motif) ligand 13 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008621 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CCL13 |
| Origin species: | Human |
| Product name: | CCL13-chemokine (C-C motif) ligand 13 Gene |
| Size: | 2ug |
| Accessions: | BC008621 |
| Gene id: | 6357 |
| Gene description: | chemokine (C-C motif) ligand 13 |
| Synonyms: | CKb10; MCP-4; NCC-1; NCC1; SCYA13; SCYL1; C-C motif chemokine 13; CK-beta-10; chemokine (C-C motif) ligand 13; monocyte chemoattractant protein 4; monocyte chemotactic protein 4; new CC chemokine 1; small inducible cytokine subfamily A (Cys-Cys), member 13; small-inducible cytokine A13; C-C motif chemokine ligand 13 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaagtctctgcagtgcttctgtgcctgctgctcatgacagcagctttcaacccccagggacttgctcagccagatgcactcaacgtcccatctacttgctgcttcacatttagcagtaagaagatctccttgcagaggctgaagagctatgtgatcaccaccagcaggtgtccccagaaggctgtcatcttcagaaccaaactgggcaaggagatctgtgctgacccaaaggagaagtgggtccagaattatatgaaacacctgggccggaaagctcacaccctgaagacttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - 4-aminobutyrate aminotransferase - PYD and CARD domain containing - ubiquitin specific peptidase 47 - synovial sarcoma, X breakpoint 2 |