Login to display prices
Login to display prices
CCL22-chemokine (C-C motif) ligand 22 Gene View larger

CCL22-chemokine (C-C motif) ligand 22 Gene

PTXBC027952

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCL22-chemokine (C-C motif) ligand 22 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CCL22-chemokine (C-C motif) ligand 22 Gene

Proteogenix catalog: PTXBC027952
Ncbi symbol: CCL22
Product name: CCL22-chemokine (C-C motif) ligand 22 Gene
Size: 2ug
Accessions: BC027952
Gene id: 6367
Gene description: chemokine (C-C motif) ligand 22
Synonyms: A-152E5.1; ABCD-1; DC/B-CK; MDC; SCYA22; STCP-1; C-C motif chemokine 22; CC chemokine STCP-1; MDC(1-69); chemokine (C-C motif) ligand 22; macrophage-derived chemokine; small inducible cytokine A22; small inducible cytokine subfamily A (Cys-Cys), member 22; stimulated T cell chemotactic protein 1; C-C motif chemokine ligand 22
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctcgcctacagactgcactcctggttgtcctcgtcctccttgctgtggcgcttcaagcaactgaggcaggcccctacggcgccaacatggaagacagcgtctgctgccgtgattacgtccgttaccgtctgcccctgcgcgtggtgaaacacttctactggacctcagactcctgcccgaggcctggcgtggtgttgctaaccttcagggataaggagatctgtgccgatcccagagtgccctgggtgaagatgattctcaataagctgagccaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice