PTXBC030200
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC030200 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FAM171A2 |
| Origin species: | Human |
| Product name: | FAM171A2-family with sequence similarity 171, member A2 Gene |
| Size: | 2ug |
| Accessions: | BC030200 |
| Gene id: | 284069 |
| Gene description: | family with sequence similarity 171, member A2 |
| Synonyms: | protein FAM171A2; family with sequence similarity 171 member A2 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgtttgggaaccggactctgctggcagctggcaccacagactcagagggtgtggccaccctgcccctcagttatcgcttgggcacctgggtgctggtcactgctgcccgccctggcttcctcaccaactctgtgccctggcgtgttgacaagctgcccttgtatgcgtctgtcagcctctacctgctccctgagcggccggccacgctcatcctctatgaggacctggtgcacattctcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - ER degradation enhancer, mannosidase alpha-like 3 - cyclin-dependent kinase inhibitor 1A (p21, Cip1) - FUS interacting protein (serine/arginine-rich) 1 - cyclin-dependent kinase inhibitor 1B (p27, Kip1) |