Login to display prices
Login to display prices
FAM171A2-family with sequence similarity 171, member A2 Gene View larger

FAM171A2-family with sequence similarity 171, member A2 Gene

PTXBC030200

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM171A2-family with sequence similarity 171, member A2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM171A2-family with sequence similarity 171, member A2 Gene

Proteogenix catalog: PTXBC030200
Ncbi symbol: FAM171A2
Product name: FAM171A2-family with sequence similarity 171, member A2 Gene
Size: 2ug
Accessions: BC030200
Gene id: 284069
Gene description: family with sequence similarity 171, member A2
Synonyms: protein FAM171A2; family with sequence similarity 171 member A2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgtttgggaaccggactctgctggcagctggcaccacagactcagagggtgtggccaccctgcccctcagttatcgcttgggcacctgggtgctggtcactgctgcccgccctggcttcctcaccaactctgtgccctggcgtgttgacaagctgcccttgtatgcgtctgtcagcctctacctgctccctgagcggccggccacgctcatcctctatgaggacctggtgcacattctcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: