FAM171A2-family with sequence similarity 171, member A2 Gene View larger

FAM171A2-family with sequence similarity 171, member A2 Gene

PTXBC030200

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM171A2-family with sequence similarity 171, member A2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM171A2-family with sequence similarity 171, member A2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030200
Product type: DNA & cDNA
Ncbi symbol: FAM171A2
Origin species: Human
Product name: FAM171A2-family with sequence similarity 171, member A2 Gene
Size: 2ug
Accessions: BC030200
Gene id: 284069
Gene description: family with sequence similarity 171, member A2
Synonyms: protein FAM171A2; family with sequence similarity 171 member A2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgtttgggaaccggactctgctggcagctggcaccacagactcagagggtgtggccaccctgcccctcagttatcgcttgggcacctgggtgctggtcactgctgcccgccctggcttcctcaccaactctgtgccctggcgtgttgacaagctgcccttgtatgcgtctgtcagcctctacctgctccctgagcggccggccacgctcatcctctatgaggacctggtgcacattctcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ER degradation enhancer, mannosidase alpha-like 3
- cyclin-dependent kinase inhibitor 1A (p21, Cip1)
- FUS interacting protein (serine/arginine-rich) 1
- cyclin-dependent kinase inhibitor 1B (p27, Kip1)

Buy FAM171A2-family with sequence similarity 171, member A2 Gene now

Add to cart