SNRPG-small nuclear ribonucleoprotein polypeptide G Gene View larger

SNRPG-small nuclear ribonucleoprotein polypeptide G Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SNRPG-small nuclear ribonucleoprotein polypeptide G Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SNRPG-small nuclear ribonucleoprotein polypeptide G Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000070
Product type: DNA & cDNA
Ncbi symbol: SNRPG
Origin species: Human
Product name: SNRPG-small nuclear ribonucleoprotein polypeptide G Gene
Size: 2ug
Accessions: BC000070
Gene id: 6637
Gene description: small nuclear ribonucleoprotein polypeptide G
Synonyms: SMG; Sm-G; small nuclear ribonucleoprotein G; sm protein G; snRNP-G; small nuclear ribonucleoprotein polypeptide G
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcaaagctcaccctcccgagttgaaaaaatttatggacaagaagttatcattgaaattaaatggtggcagacatgtccaaggaatattgcggggatttgatccctttatgaaccttgtgatagatgaatgtgtggagatggcgactagtggacaacagaacaatattggaatggtggtaatacgaggaaatagtatcatcatgttagaagccttggaacgagtataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - poly(A) binding protein interacting protein 2
- peptidylprolyl isomerase (cyclophilin)-like 4
- MAD2 mitotic arrest deficient-like 1 (yeast)
- zinc finger CCHC-type and RNA binding motif 1

Buy SNRPG-small nuclear ribonucleoprotein polypeptide G Gene now

Add to cart