Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of SNRPG-small nuclear ribonucleoprotein polypeptide G Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SNRPG-small nuclear ribonucleoprotein polypeptide G Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000070 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SNRPG |
| Origin species: | Human |
| Product name: | SNRPG-small nuclear ribonucleoprotein polypeptide G Gene |
| Size: | 2ug |
| Accessions: | BC000070 |
| Gene id: | 6637 |
| Gene description: | small nuclear ribonucleoprotein polypeptide G |
| Synonyms: | SMG; Sm-G; small nuclear ribonucleoprotein G; sm protein G; snRNP-G; small nuclear ribonucleoprotein polypeptide G |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagcaaagctcaccctcccgagttgaaaaaatttatggacaagaagttatcattgaaattaaatggtggcagacatgtccaaggaatattgcggggatttgatccctttatgaaccttgtgatagatgaatgtgtggagatggcgactagtggacaacagaacaatattggaatggtggtaatacgaggaaatagtatcatcatgttagaagccttggaacgagtataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - poly(A) binding protein interacting protein 2 - peptidylprolyl isomerase (cyclophilin)-like 4 - MAD2 mitotic arrest deficient-like 1 (yeast) - zinc finger CCHC-type and RNA binding motif 1 |