Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PPIL4-peptidylprolyl isomerase (cyclophilin)-like 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPIL4-peptidylprolyl isomerase (cyclophilin)-like 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016984 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPIL4 |
| Origin species: | Human |
| Product name: | PPIL4-peptidylprolyl isomerase (cyclophilin)-like 4 Gene |
| Size: | 2ug |
| Accessions: | BC016984 |
| Gene id: | 85313 |
| Gene description: | peptidylprolyl isomerase (cyclophilin)-like 4 |
| Synonyms: | rotamase PPIL4; cyclophilin-like protein PPIL4; HDCME13P; peptidyl-prolyl cis-trans isomerase-like 4; PPIase; cyclophilin-type peptidyl-prolyl cis-trans isomerase; peptidylprolyl isomerase (cyclophilin)-like 4; serologically defined breast cancer antigen NY-BR-18; peptidylprolyl isomerase like 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacaatgtgcttatagatgacagaagaatacatgtggattttagccagtcggttgcaaaggttaaatggaaaggaaaaggtgggaaatacaccaagagtgatttcaaggagtatgaaaaagaacaggataaaccacctaatttggttctgaaagataaagtaaagcccaaacaggatacaaaatacgatcttatattagatgagcaggccgaagactcaaaatcaagtcactcacacacaagtaaaaaacacaagaagaaaacccatcactgttctgaagagaaagaagatgaggactacatgccaatcaaaaatactaatcaggatatctatagagaaatggggtttggtcactatgaagaagaagaaagctgttgggagaaacaaaagagtgaaaagagagaccgaactcagaaccgaagtcgtagccgatctcgagagagggatggccattatagtaatagtcataaatcaaaataccaaacagatctttatgaaagagaaaggagtaaaaagagagaccgaagcagaagtccaaagaagtccaaagataaagaaaaatctaagtatagatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - MAD2 mitotic arrest deficient-like 1 (yeast) - zinc finger CCHC-type and RNA binding motif 1 - family with sequence similarity 60, member A - proprotein convertase subtilisin/kexin type 4 |