PPIL4-peptidylprolyl isomerase (cyclophilin)-like 4 Gene View larger

PPIL4-peptidylprolyl isomerase (cyclophilin)-like 4 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPIL4-peptidylprolyl isomerase (cyclophilin)-like 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PPIL4-peptidylprolyl isomerase (cyclophilin)-like 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016984
Product type: DNA & cDNA
Ncbi symbol: PPIL4
Origin species: Human
Product name: PPIL4-peptidylprolyl isomerase (cyclophilin)-like 4 Gene
Size: 2ug
Accessions: BC016984
Gene id: 85313
Gene description: peptidylprolyl isomerase (cyclophilin)-like 4
Synonyms: rotamase PPIL4; cyclophilin-like protein PPIL4; HDCME13P; peptidyl-prolyl cis-trans isomerase-like 4; PPIase; cyclophilin-type peptidyl-prolyl cis-trans isomerase; peptidylprolyl isomerase (cyclophilin)-like 4; serologically defined breast cancer antigen NY-BR-18; peptidylprolyl isomerase like 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacaatgtgcttatagatgacagaagaatacatgtggattttagccagtcggttgcaaaggttaaatggaaaggaaaaggtgggaaatacaccaagagtgatttcaaggagtatgaaaaagaacaggataaaccacctaatttggttctgaaagataaagtaaagcccaaacaggatacaaaatacgatcttatattagatgagcaggccgaagactcaaaatcaagtcactcacacacaagtaaaaaacacaagaagaaaacccatcactgttctgaagagaaagaagatgaggactacatgccaatcaaaaatactaatcaggatatctatagagaaatggggtttggtcactatgaagaagaagaaagctgttgggagaaacaaaagagtgaaaagagagaccgaactcagaaccgaagtcgtagccgatctcgagagagggatggccattatagtaatagtcataaatcaaaataccaaacagatctttatgaaagagaaaggagtaaaaagagagaccgaagcagaagtccaaagaagtccaaagataaagaaaaatctaagtatagatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - MAD2 mitotic arrest deficient-like 1 (yeast)
- zinc finger CCHC-type and RNA binding motif 1
- family with sequence similarity 60, member A
- proprotein convertase subtilisin/kexin type 4

Buy PPIL4-peptidylprolyl isomerase (cyclophilin)-like 4 Gene now

Add to cart