Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of ZCRB1-zinc finger CCHC-type and RNA binding motif 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ZCRB1-zinc finger CCHC-type and RNA binding motif 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022543 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ZCRB1 |
| Origin species: | Human |
| Product name: | ZCRB1-zinc finger CCHC-type and RNA binding motif 1 Gene |
| Size: | 2ug |
| Accessions: | BC022543 |
| Gene id: | 85437 |
| Gene description: | zinc finger CCHC-type and RNA binding motif 1 |
| Synonyms: | MADP-1; MADP1; RBM36; SNRNP31; ZCCHC19; zinc finger CCHC-type and RNA-binding motif-containing protein 1; U11/U12 small nuclear ribonucleoprotein 31 kDa protein; U11/U12 snRNP 31 kDa protein; U11/U12 snRNP 31K; U11/U12-31K; zinc finger CCHC-type and RNA binding motif 1; zinc finger CCHC-type and RNA binding motif containing 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtggtggattggctccaagtaagagcacagtgtatgtatccaacttgcctttttccctgacaaacaatgacttgtaccggatattttccaagtatggcaaagttgtaaaggttaccatcatgaaagataaagataccaggaagagtaaaggggttgcatttattttatttttggataaagactctgcacaaaactgtaccagggcaataaacaacaaacagttatttggtagagtgataaaagcaagcattgctattgacaatggaagagcagctgagttcatccgaaggcgaaactactttgataaatctaagtgttatgaatgtggggaaagtggacacttaagttatgcctgtccgaaaaatatgctcggagaacgtgagcctcaaaagaagaaagaaaaaaagaaaaaaaagaaagctcctgaaccagaagaagaaattgaggaagtagaagaaagtgaagatgaaggggaggatcctgctcttgacagcctcagtcaggccatagcattccagcaagccaaaattgaagaagaacaaaaaaaatggaaacccagttcaggagtcccctcaacatcagatgattcaagacgcccaaggataaagaaaagcacatatttcagtgatgaggaagaacttagtgattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 60, member A - proprotein convertase subtilisin/kexin type 4 - small nuclear ribonucleoprotein polypeptide A - family with sequence similarity 53, member B |