Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of SNRPA-small nuclear ribonucleoprotein polypeptide A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SNRPA-small nuclear ribonucleoprotein polypeptide A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000405 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SNRPA |
| Origin species: | Human |
| Product name: | SNRPA-small nuclear ribonucleoprotein polypeptide A Gene |
| Size: | 2ug |
| Accessions: | BC000405 |
| Gene id: | 6626 |
| Gene description: | small nuclear ribonucleoprotein polypeptide A |
| Synonyms: | Mud1; U1-A; U1A; U1 small nuclear ribonucleoprotein A; U1 small nuclear RNP-specific A; U1 snRNP A; U1 snRNP-specific protein A; small nuclear ribonucleoprotein polypeptide A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagttcccgagacccgccctaaccacactatttatatcaacaacctcaatgagaagatcaagaaggatgagctaaaaaagtccctgtacgccatcttctcccagtttggccagatcctggatatcctggtatcacggagcctgaagatgaggggccaggcctttgtcatcttcaaggaggtcagcagcgccaccaacgccctgcgctccatgcagggtttccctttctatgacaaacctatgcgtatccagtatgccaagaccgactcagatatcattgccaagatgaaaggcaccttcgtggagcgggaccgcaagcgggagaagaggaagcccaagagccaggagaccccggccaccaagaaggctgtgcaaggcgggggagccacccccgtggtgggggctgtccaggggcctgtcccgggcatgccgccgatgactcaggcgccccgcattatgcaccacatgccgggccagccgccctacatgccgccccctggtatgatccccccgccaggccttgcacctggccagatcccaccaggggccatgcccccgcagcagcttatgccaggacagatgccccctgcccagcctctttctgagaatccaccgaatcacatcttgttcctcaccaacctgccagaggagaccaacgagctcatgctgtccatgcttttcaatcagttccctggcttcaaggaggtccgtctggtacccgggcggcatgacatcgccttcgtggagtttgacaatgaggtacaggcaggggcagctcgcgatgccctgcagggctttaagatcacgcagaacaacgccatgaagatctcctttgccaagaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 53, member B - family with sequence similarity 86, member C - dehydrogenase/reductase (SDR family) member 1 - family with sequence similarity 70, member B |