DHRS1-dehydrogenase/reductase (SDR family) member 1 Gene View larger

DHRS1-dehydrogenase/reductase (SDR family) member 1 Gene

PTXBC014057

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DHRS1-dehydrogenase/reductase (SDR family) member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DHRS1-dehydrogenase/reductase (SDR family) member 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014057
Product type: DNA & cDNA
Ncbi symbol: DHRS1
Origin species: Human
Product name: DHRS1-dehydrogenase/reductase (SDR family) member 1 Gene
Size: 2ug
Accessions: BC014057
Gene id: 115817
Gene description: dehydrogenase/reductase (SDR family) member 1
Synonyms: SDR19C1; dehydrogenase/reductase SDR family member 1; dehydrogenase/reductase (SDR family) member 1; short chain dehydrogenase/reductase family 19C member 1; dehydrogenase/reductase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagctcccatgaatggccaagtgtgtgtggtgactggtgcctccaggggtattggccgtggcattgccttgcagctctgcaaagcaggcgccacagtttacatcactggccgccatctggacacccttcgcgttgttgctcaggaggcacaatccctcgggggccaatgtgtgcctgtggtgtgcgattcaagccaggagagtgaagtgcgaagcctgtttgagcaagtggatcgggaacagcaagggcgtctagatgtgctggtcaacaatgcttatgcaggggtccagacgatcctgaacaccaggaataaggcattctgggaaacccctgcctccatgtgggatgatatcaacaacgtcggactcagaggccactacttttgctcagtgtatggggcacggctgatggtaccagctggccaggggctcatcgtggtcatctcctccccaggaagcctgcagtatatgttcaatgtcctctatggtgtgggcaaagctgcgtgtgacaagctggctgctgactgtgcccacgagctgcggcgccatggggtcagctgtgtgtctctgtggccggggattgtgcagacagaactgctgaaggagcatatggcaaaggaggaggtcctgcaggatcctgtgttgaagcagttcaaatcagccttctcatctgcggaaaccacagaattgagtggcaaatgtgtggtggctttggcaacagatcccaatatcctgagcctgagtggtaaggtgctgccatcctgtgaccttgctcgacgctatggccttcgggatgtggacggccgccccgtccaagactatttgtctttgagctctgttctctcacacgtgtccggcctgggctggctggcctcctacctgccctccttcctccgtgtgcccaagtggattattgccctctacactagcaagttctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 70, member B
- poly (ADP-ribose) polymerase family, member 6
- tumor suppressing subtransferable candidate 1
- minichromosome maintenance complex component 7

Buy DHRS1-dehydrogenase/reductase (SDR family) member 1 Gene now

Add to cart