Login to display prices
Login to display prices
MAD2L1-MAD2 mitotic arrest deficient-like 1 (yeast) Gene View larger

MAD2L1-MAD2 mitotic arrest deficient-like 1 (yeast) Gene

PTXBC000356

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAD2L1-MAD2 mitotic arrest deficient-like 1 (yeast) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MAD2L1-MAD2 mitotic arrest deficient-like 1 (yeast) Gene

Proteogenix catalog: PTXBC000356
Ncbi symbol: MAD2L1
Product name: MAD2L1-MAD2 mitotic arrest deficient-like 1 (yeast) Gene
Size: 2ug
Accessions: BC000356
Gene id: 4085
Gene description: MAD2 mitotic arrest deficient-like 1 (yeast)
Synonyms: HSMAD2; mitotic spindle assembly checkpoint protein MAD2A; MAD2 (mitotic arrest deficient, yeast, homolog)-like 1; MAD2-like protein 1; mitotic arrest deficient 2-like protein 1; mitotic arrest deficient, yeast, homolog-like 1; MAD2 mitotic arrest deficient-like 1 (yeast)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgctgcagctctcccgggagcagggaatcaccctgcgcgggagcgccgaaatcgtggccgagttcttctcattcggcatcaacagcattttatatcagcgtggcatatatccatctgaaacctttactcgagtgcagaaatacggactcaccttgcttgtaactactgatcttgagctcataaaatacctaaataatgtggtggaacaactgaaagattggttatacaagtgttcagttcagaaactggttgtagttatctcaaatattgaaagtggtgaggtcctggaaagatggcagtttgatattgagtgtgacaagactgcaaaagatgacagtgcacccagagaaaagtctcagaaagctatccaggatgaaatccgttcagtgatcagacagatcacagctacggtgacatttctgccactgttggaagtttcttgttcatttgatctgctgatttatacagacaaagatttggttgtacctgaaaaatgggaagagtcgggaccacagtttattaccaattctgaggaagtccgccttcgttcatttactactacaatccacaaagtaaatagcatggtggcctacaaaattcctgtcaatgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: