Login to display prices
Login to display prices
PAIP2-poly(A) binding protein interacting protein 2 Gene View larger

PAIP2-poly(A) binding protein interacting protein 2 Gene

PTXBC001716

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PAIP2-poly(A) binding protein interacting protein 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PAIP2-poly(A) binding protein interacting protein 2 Gene

Proteogenix catalog: PTXBC001716
Ncbi symbol: PAIP2
Product name: PAIP2-poly(A) binding protein interacting protein 2 Gene
Size: 2ug
Accessions: BC001716
Gene id: 51247
Gene description: poly(A) binding protein interacting protein 2
Synonyms: PAIP-2; PAIP2A; polyadenylate-binding protein-interacting protein 2; PABC1-interacting protein 2; PABP-interacting protein 2; polyA-binding protein-interacting protein 2; poly(A) binding protein interacting protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaagatccaagtcgcagcagtactagcccaagcatcatcaatgaagatgtgattattaacggtcattctcatgaagatgacaatccatttgcagagtacatgtggatggaaaatgaagaagaattcaacagacaaatagaagaggagttatgggaagaagaatttattgaacgctgtttccaagaaatgctggaagaggaagaagagcatgaatggtttattccagctcgagatctcccacaaactatggaccaaatccaagaccagtttaatgaccttgttatcagtgatggctcttctctggaagatcttgtggtcaagagcaatctgaatccaaatgcaaaggagtttgttcctggggtgaagtacggaaatatttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: