Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RBM26-RNA binding motif protein 26 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RBM26-RNA binding motif protein 26 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000791 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RBM26 |
| Origin species: | Human |
| Product name: | RBM26-RNA binding motif protein 26 Gene |
| Size: | 2ug |
| Accessions: | BC000791 |
| Gene id: | 64062 |
| Gene description: | RNA binding motif protein 26 |
| Synonyms: | ARRS2; C13orf10; PPP1R132; PRO1777; SE70-2; ZC3H17; RNA-binding protein 26; CTCL tumor antigen se70-2; acidic rich RS domain containing 2; cutaneous T-cell lymphoma tumor antigen se70-2; protein phosphatase 1, regulatory 132; RNA binding motif protein 26 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccgaggcagggggcgagggcgagggcgaggtgtgcctggtcatgctgtggtggatcaccgtcccagggcattggagatttctgcatttacggagagcgatagagaagatcttcttcctcattttgcgcaatatggtgaaattgaagattgtcagattgatgattcctcacttcatgcagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - similar to hCG1991536 - crumbs homolog 3 (Drosophila) - Yip1 domain family, member 1 - H2A histone family, member V |