Login to display prices
Login to display prices
RBM26-RNA binding motif protein 26 Gene View larger

RBM26-RNA binding motif protein 26 Gene

PTXBC000791

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RBM26-RNA binding motif protein 26 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RBM26-RNA binding motif protein 26 Gene

Proteogenix catalog: PTXBC000791
Ncbi symbol: RBM26
Product name: RBM26-RNA binding motif protein 26 Gene
Size: 2ug
Accessions: BC000791
Gene id: 64062
Gene description: RNA binding motif protein 26
Synonyms: ARRS2; C13orf10; PPP1R132; PRO1777; SE70-2; ZC3H17; RNA-binding protein 26; CTCL tumor antigen se70-2; acidic rich RS domain containing 2; cutaneous T-cell lymphoma tumor antigen se70-2; protein phosphatase 1, regulatory 132; RNA binding motif protein 26
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgaggcagggggcgagggcgagggcgaggtgtgcctggtcatgctgtggtggatcaccgtcccagggcattggagatttctgcatttacggagagcgatagagaagatcttcttcctcattttgcgcaatatggtgaaattgaagattgtcagattgatgattcctcacttcatgcagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: