LOC100130950-similar to hCG1991536 Gene View larger

LOC100130950-similar to hCG1991536 Gene

PTXBC029580

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LOC100130950-similar to hCG1991536 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LOC100130950-similar to hCG1991536 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029580
Product type: DNA & cDNA
Ncbi symbol: LOC100130950
Origin species: Human
Product name: LOC100130950-similar to hCG1991536 Gene
Size: 2ug
Accessions: BC029580
Gene id: 100130950
Gene description: similar to hCG1991536
Synonyms: uncharacterized LOC100130950
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaccaaggaaaggccatttgtggggacatagcaagaaggcagctgtctgcaagccaggaggagaaccctcaccagaaacctcacagaaatcggccaacaccctcatctcgggcttccagcttcagaacaacgagaaaacaaatttctgttgtgtcctggttcccatttgtaattggcaccctaatgaaaccgttttctgtagccctggaaatggctgaaaatgaggggagggaaataaagtgctataattcagagcatggagcacaccttcctggttcacctgagctggattcggagaggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - crumbs homolog 3 (Drosophila)
- Yip1 domain family, member 1
- H2A histone family, member V
- hypothetical LOC26070

Buy LOC100130950-similar to hCG1991536 Gene now

Add to cart