H2AFV-H2A histone family, member V Gene View larger

H2AFV-H2A histone family, member V Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of H2AFV-H2A histone family, member V Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about H2AFV-H2A histone family, member V Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000098
Product type: DNA & cDNA
Ncbi symbol: H2AFV
Origin species: Human
Product name: H2AFV-H2A histone family, member V Gene
Size: 2ug
Accessions: BC000098
Gene id: 94239
Gene description: H2A histone family, member V
Synonyms: H2A.Z-2; H2AV; histone H2A.V; H2A.F/Z; histone H2A.F/Z; purine-rich binding element protein B; H2A histone family member V
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctggaggcaaagctggaaaggacagtgggaaggccaaggctaaggcagtatctcgctcacagagagctgggctacagtttcctgtgggccgcatccacagacacttgaagactcgcaccacaagccatggaagggtgggtgccactgctgccgtgtacagtgctgcgattctggagtacctcactgcagaggtgctggagctggcaggtaatgcttctaaggatctcaaagtaaagcgtatcactccgcgtcacttgcagcttgcaatccgtggtgatgaagagttggattctcttatcaaggctaccatagctgggggtggtgtgatccctcacatccacaaatctctgattggaaagaagggacagcagaaaactgcttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical LOC26070
- Niemann-Pick disease, type C2
- collagen, type XX, alpha 1
- receptor accessory protein 6

Buy H2AFV-H2A histone family, member V Gene now

Add to cart