YIPF1-Yip1 domain family, member 1 Gene View larger

YIPF1-Yip1 domain family, member 1 Gene

PTXBC009674

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of YIPF1-Yip1 domain family, member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about YIPF1-Yip1 domain family, member 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009674
Product type: DNA & cDNA
Ncbi symbol: YIPF1
Origin species: Human
Product name: YIPF1-Yip1 domain family, member 1 Gene
Size: 2ug
Accessions: BC009674
Gene id: 54432
Gene description: Yip1 domain family, member 1
Synonyms: protein YIPF1; DJ167A19.1; FinGER1; YIP1 family member 1; Yip1 domain family member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggagaaacagcaaagttatgaacatcgtctcctattcatttctggagattgtgtgtgtctatggatattccctcttcatttatatccccaccgcaatactgtggattatcccccagaaagctgttcgttggattctagtcatgattgccctgggcatctcaggatctctcttggcaatgacattttggccagctgttcgtgaggataaccgacgcgttgcattggccacaattgtgacaattgtgttgctccatatgctgctttctgtgggctgcttggcatacttttttgatgcaccagagatggaccatctcccaacaactacagctactccaaaccaaacagttgctgcagccaagtccagctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - H2A histone family, member V
- hypothetical LOC26070
- Niemann-Pick disease, type C2
- collagen, type XX, alpha 1

Buy YIPF1-Yip1 domain family, member 1 Gene now

Add to cart