CRB3-crumbs homolog 3 (Drosophila) Gene View larger

CRB3-crumbs homolog 3 (Drosophila) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CRB3-crumbs homolog 3 (Drosophila) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CRB3-crumbs homolog 3 (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018409
Product type: DNA & cDNA
Ncbi symbol: CRB3
Origin species: Human
Product name: CRB3-crumbs homolog 3 (Drosophila) Gene
Size: 2ug
Accessions: BC018409
Gene id: 92359
Gene description: crumbs homolog 3 (Drosophila)
Synonyms: protein crumbs homolog 3; crumbs family member 3; crumbs 3, cell polarity complex component
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgaaccccgggctggggctgcttctggcgctgggcctgccgttcctgctggcccgctggggccgagcctgggggcaaatacagaccacttctgcaaatgagaatagcactgttttgccttcatccaccagctccagctccgatggcaacctgcgtccggaagccatcactgctatcatcgtggtcttctccctcttggctgccttgctcctggctgtggggctggcactgttggtgcggaagcttcgggagaagcggcagacggagggcacctaccggcccagtagcgaggagcagttctcccatgcagccgaggcccgggcccctcaggactccaaggagacggtgcagggctgcctgcccatctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Yip1 domain family, member 1
- H2A histone family, member V
- hypothetical LOC26070
- Niemann-Pick disease, type C2

Buy CRB3-crumbs homolog 3 (Drosophila) Gene now

Add to cart