ZNF85-zinc finger protein 85 Gene View larger

ZNF85-zinc finger protein 85 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF85-zinc finger protein 85 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF85-zinc finger protein 85 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008688
Product type: DNA & cDNA
Ncbi symbol: ZNF85
Origin species: Human
Product name: ZNF85-zinc finger protein 85 Gene
Size: 2ug
Accessions: BC008688
Gene id: 7639
Gene description: zinc finger protein 85
Synonyms: HPF4; HTF1; zinc finger protein 85; zinc finger protein 85 (HPF4, HTF1)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttagagaactacagaaacctggtcttcctgggtattactgtttctaagccagacctgatcacttgtctggagcaagggaaagaggcctggagtatgaagagacatgagatcatggtggccaaacccacagaatcttactctgtcacccagtctggaatgcagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - LYR motif containing 1
- tachykinin, precursor 1
- ring finger protein 24
- zinc finger protein 44

Buy ZNF85-zinc finger protein 85 Gene now

Add to cart