AAAS-achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A) Gene View larger

AAAS-achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A) Gene


New product

Data sheet of AAAS-achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about AAAS-achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000659
Product type: DNA & cDNA
Ncbi symbol: AAAS
Origin species: Human
Product name: AAAS-achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A) Gene
Size: 2ug
Accessions: BC000659
Gene id: 8086
Gene description: achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A)
Synonyms: AAA; AAASb; ADRACALA; ADRACALIN; ALADIN; GL003; Allgrove, triple-A; achalasia, adrenocortical insufficiency, alacrimia; aladin WD repeat nucleoporin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgctctctggggttgttccctcctccaccgcctcggggtcaagtcaccctatatgagcacaataacgagctggtgacgggcagtagctatgagagcccgccccccgacttccggggccagtggatcaatcttcctgtcctacaactgacaaaggatcccctaaagacccctggaaggctggaccatggcacaagaactgccttcatccatcaccgggagcaagtgtggaagagatgcatcaacatttggcgtgatgtgggcctttttggggtgctaaatgaaattgcaaactcagaagaagaggtgtttgagtgggtgaagacggcatccggctgggccctggcactctgtcgatgggcctcttccctccatgggtccctgttcccccatctgtctctcaggagcgaagatctgatcgctgaatttgcccaagtcacaaattggtccagctgctgcttgcgtgtctttgcatggcacccccacaccaacaagtttgcagtggccctgctagatgactcagtccgtgtgtataatgccagcagcaccatagtcccctccctgaagcaccggctgcagcgaaatgtggcgtctctggcctggaagccccttagtgcctctgtcttggctgtggcctgccagagctgcattcttatctggaccctggaccctacctccttgtctacccgaccctcttctggctgtgcccaagtgctgtctcaccctgggcatacacctgttaccagcttggcctgggcccccagtggggggcggctgctctcagcttcacccgtggatgctgctatccgggtatgggatgtctcaacagagacctgtgtcccccttccctggtttcgaggaggtggggtgaccaacctgctctggtccccagacggcagcaaaatcctggctaccactccttcagctgtctttcgagtctgggaggcccagatgtggacttgtgagaggtggcctactctatcagggcgctgtcagactggctgctggagcccagatggcagccgactgctgttcactgtattgggagagccactgatttactccctgtcttttccagaacgttgtggtgagggaaaggggtgcgttggaggtgcaaagtcagcaacgattgtggcagatctgtctgagacaacaatacagacaccagatggtgaggagaggcttgggggagaggctcactccatggtctgggaccccagtggggaacgtctggctgtgcttatgaaaggaaagccaagggtacaggatggtaaaccagtcatcctcctttttcgcactcgaaacagccctgtgtttgagctccttccctgtggcattatccagggggagccaggagcccagccccagctcatcactttccatccttccttcaacaaaggggccctgctcagtgtgggctggtccacaggccgaattgcccacatcccgctgtactttgtcaatgcccagtttccacgttttagcccagtgcttgggcgggcccaggaaccccctgctgggggtggaggctctattcatgacctgcccctctttactgagacatccccaacctctgccccttgggaccctctcccagggccaccacctgttctgccccactccccacattcccacctctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hyperpolarization activated cyclic nucleotide-gated potassium channel 3
- ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit
- vesicle transport through interaction with t-SNAREs homolog 1A (yeast)
- dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit

Buy AAAS-achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A) Gene now

Add to cart