HCN3-hyperpolarization activated cyclic nucleotide-gated potassium channel 3 Gene View larger

HCN3-hyperpolarization activated cyclic nucleotide-gated potassium channel 3 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HCN3-hyperpolarization activated cyclic nucleotide-gated potassium channel 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HCN3-hyperpolarization activated cyclic nucleotide-gated potassium channel 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028024
Product type: DNA & cDNA
Ncbi symbol: HCN3
Origin species: Human
Product name: HCN3-hyperpolarization activated cyclic nucleotide-gated potassium channel 3 Gene
Size: 2ug
Accessions: BC028024
Gene id: 57657
Gene description: hyperpolarization activated cyclic nucleotide-gated potassium channel 3
Synonyms: potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 3; hyperpolarization activated cyclic nucleotide gated potassium channel 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctcagcatgatcgtaggtgccacatgctacgccatgttcatcggccatgccacggcactcatccagtccctggactcttcccggcgtcagtaccaggagaagtacaagcaggtggagcagtacatgtccttccacaagctgccagcagacacgcggcagcgcatccacgagtactatgagcaccgctaccagggcaagatgttcgatgaggaaagcatcctgggcgagctgagcgagccgcttcgcgaggagatcattaacttcacctgtcggggcctggtggcccacatgccgctgtttgcccatgccgaccccagcttcgtcactgcagttctcaccaagctgcgctttgaggtcttccagccgggggatctcgtggtgcgtgagggctccgtggggaggaagatgtacttcatccagcatgggctgctcagtgtgctggcccgcggcgcccgggacacacgcctcaccgatggatcctactttggggagatctgcctgctaactaggggccggcgcacagccagtgttcgggctgacacctactgccgcctttactcactcagcgtggaccatttcaatgctgtgcttgaggagttccccatgatgcgccgggcctttgagactgtggccatggatcggctgctccgcatcggcaagaagaattccatactgcagcggaagcgctccgagccaagtccaggcagcagtggtggcatcatggagcagcacttggtgcaacatgacagagacatggctcggggtgttcggggtcgggccccgagcacaggagctcagcttagtggaaagccagtactgtgggagccactggtacatgcgccccttcaggcagctgctgtgacctccaatgtggccattgccctgactcatcagcggggccctctgcccctctcccctgactctccagccaccctccttgctcgctctgcttggcgctcagcaggctctccagcttccccgctggtgcccgtccgagctggcccatgggcatccacctcccgcctgcccgccccacctgcccgaaccctgcacgccagcctatcccgggcagggcgctcccaggtctccctgctgggtccccctccaggaggaggtggacggcggctaggacctcggggccgcccactctcagcctcccaaccctctctgcctcagcgggcaacaggcgatggctctcctgggcgtaagggatcaggaagtgagcggctgcctccctcagggctcctggccaaacctccaaggacagcccagccccccaggccaccagtgcctgagccagccacaccccggggtctccagctttctgccaacatgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit
- vesicle transport through interaction with t-SNAREs homolog 1A (yeast)
- dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit
- solute carrier family 12 (potassium/chloride transporters), member 7

Buy HCN3-hyperpolarization activated cyclic nucleotide-gated potassium channel 3 Gene now

Add to cart