Login to display prices
Login to display prices
HCN3-hyperpolarization activated cyclic nucleotide-gated potassium channel 3 Gene View larger

HCN3-hyperpolarization activated cyclic nucleotide-gated potassium channel 3 Gene

PTXBC028024

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HCN3-hyperpolarization activated cyclic nucleotide-gated potassium channel 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HCN3-hyperpolarization activated cyclic nucleotide-gated potassium channel 3 Gene

Proteogenix catalog: PTXBC028024
Ncbi symbol: HCN3
Product name: HCN3-hyperpolarization activated cyclic nucleotide-gated potassium channel 3 Gene
Size: 2ug
Accessions: BC028024
Gene id: 57657
Gene description: hyperpolarization activated cyclic nucleotide-gated potassium channel 3
Synonyms: potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 3; hyperpolarization activated cyclic nucleotide gated potassium channel 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctcagcatgatcgtaggtgccacatgctacgccatgttcatcggccatgccacggcactcatccagtccctggactcttcccggcgtcagtaccaggagaagtacaagcaggtggagcagtacatgtccttccacaagctgccagcagacacgcggcagcgcatccacgagtactatgagcaccgctaccagggcaagatgttcgatgaggaaagcatcctgggcgagctgagcgagccgcttcgcgaggagatcattaacttcacctgtcggggcctggtggcccacatgccgctgtttgcccatgccgaccccagcttcgtcactgcagttctcaccaagctgcgctttgaggtcttccagccgggggatctcgtggtgcgtgagggctccgtggggaggaagatgtacttcatccagcatgggctgctcagtgtgctggcccgcggcgcccgggacacacgcctcaccgatggatcctactttggggagatctgcctgctaactaggggccggcgcacagccagtgttcgggctgacacctactgccgcctttactcactcagcgtggaccatttcaatgctgtgcttgaggagttccccatgatgcgccgggcctttgagactgtggccatggatcggctgctccgcatcggcaagaagaattccatactgcagcggaagcgctccgagccaagtccaggcagcagtggtggcatcatggagcagcacttggtgcaacatgacagagacatggctcggggtgttcggggtcgggccccgagcacaggagctcagcttagtggaaagccagtactgtgggagccactggtacatgcgccccttcaggcagctgctgtgacctccaatgtggccattgccctgactcatcagcggggccctctgcccctctcccctgactctccagccaccctccttgctcgctctgcttggcgctcagcaggctctccagcttccccgctggtgcccgtccgagctggcccatgggcatccacctcccgcctgcccgccccacctgcccgaaccctgcacgccagcctatcccgggcagggcgctcccaggtctccctgctgggtccccctccaggaggaggtggacggcggctaggacctcggggccgcccactctcagcctcccaaccctctctgcctcagcgggcaacaggcgatggctctcctgggcgtaagggatcaggaagtgagcggctgcctccctcagggctcctggccaaacctccaaggacagcccagccccccaggccaccagtgcctgagccagccacaccccggggtctccagctttctgccaacatgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: