Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ATP5D-ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit Gene
PTXBC002389
New product
Data sheet of ATP5D-ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATP5D-ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002389 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATP5D |
| Origin species: | Human |
| Product name: | ATP5D-ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit Gene |
| Size: | 2ug |
| Accessions: | BC002389 |
| Gene id: | 513 |
| Gene description: | ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit |
| Synonyms: | ATP synthase subunit delta, mitochondrial; F-ATPase delta subunit; mitochondrial ATP synthase complex delta-subunit precusor; mitochondrial ATP synthase, delta subunit; ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgcccgccgcgctgctccgccgcccgggacttggccgcctcgtccgccacgcccgtgcctatgccgaggccgccgccgccccggctgccgcctctggccccaaccagatgtccttcaccttcgcctctcccacgcaggtgttcttcaacggtgccaacgtccggcaggtggacgtgcccacgctgaccggagccttcggcatcctggcggcccacgtgcccacgctgcaggtcctgcggccggggctggtcgtggtgcatgcagaggacggcaccacctccaaatactttgtgagcagcggttccatcgcagtgaacgccgactcttcggtgcagttgttggccgaagaggccgtgacgctggacatgttggacctgggggcagccaaggcaaacttggagaaggcccaggcggagctggtggggacagctgacgaggccacgcgggcagagatccagatccgaatcgaggccaacgaggccctggtgaaggccctggagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - vesicle transport through interaction with t-SNAREs homolog 1A (yeast) - dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit - solute carrier family 12 (potassium/chloride transporters), member 7 - solute carrier family 12 (potassium/chloride transporters), member 8 |