Login to display prices
Login to display prices
ATP5D-ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit Gene View larger

ATP5D-ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit Gene

PTXBC002389

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATP5D-ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ATP5D-ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit Gene

Proteogenix catalog: PTXBC002389
Ncbi symbol: ATP5D
Product name: ATP5D-ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit Gene
Size: 2ug
Accessions: BC002389
Gene id: 513
Gene description: ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit
Synonyms: ATP synthase subunit delta, mitochondrial; F-ATPase delta subunit; mitochondrial ATP synthase complex delta-subunit precusor; mitochondrial ATP synthase, delta subunit; ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgcccgccgcgctgctccgccgcccgggacttggccgcctcgtccgccacgcccgtgcctatgccgaggccgccgccgccccggctgccgcctctggccccaaccagatgtccttcaccttcgcctctcccacgcaggtgttcttcaacggtgccaacgtccggcaggtggacgtgcccacgctgaccggagccttcggcatcctggcggcccacgtgcccacgctgcaggtcctgcggccggggctggtcgtggtgcatgcagaggacggcaccacctccaaatactttgtgagcagcggttccatcgcagtgaacgccgactcttcggtgcagttgttggccgaagaggccgtgacgctggacatgttggacctgggggcagccaaggcaaacttggagaaggcccaggcggagctggtggggacagctgacgaggccacgcgggcagagatccagatccgaatcgaggccaacgaggccctggtgaaggccctggagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice