ATP5D-ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit Gene View larger

ATP5D-ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATP5D-ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ATP5D-ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002389
Product type: DNA & cDNA
Ncbi symbol: ATP5D
Origin species: Human
Product name: ATP5D-ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit Gene
Size: 2ug
Accessions: BC002389
Gene id: 513
Gene description: ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit
Synonyms: ATP synthase subunit delta, mitochondrial; F-ATPase delta subunit; mitochondrial ATP synthase complex delta-subunit precusor; mitochondrial ATP synthase, delta subunit; ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgcccgccgcgctgctccgccgcccgggacttggccgcctcgtccgccacgcccgtgcctatgccgaggccgccgccgccccggctgccgcctctggccccaaccagatgtccttcaccttcgcctctcccacgcaggtgttcttcaacggtgccaacgtccggcaggtggacgtgcccacgctgaccggagccttcggcatcctggcggcccacgtgcccacgctgcaggtcctgcggccggggctggtcgtggtgcatgcagaggacggcaccacctccaaatactttgtgagcagcggttccatcgcagtgaacgccgactcttcggtgcagttgttggccgaagaggccgtgacgctggacatgttggacctgggggcagccaaggcaaacttggagaaggcccaggcggagctggtggggacagctgacgaggccacgcgggcagagatccagatccgaatcgaggccaacgaggccctggtgaaggccctggagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - vesicle transport through interaction with t-SNAREs homolog 1A (yeast)
- dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit
- solute carrier family 12 (potassium/chloride transporters), member 7
- solute carrier family 12 (potassium/chloride transporters), member 8

Buy ATP5D-ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit Gene now

Add to cart