VTI1A-vesicle transport through interaction with t-SNAREs homolog 1A (yeast) Gene View larger

VTI1A-vesicle transport through interaction with t-SNAREs homolog 1A (yeast) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VTI1A-vesicle transport through interaction with t-SNAREs homolog 1A (yeast) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about VTI1A-vesicle transport through interaction with t-SNAREs homolog 1A (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017052
Product type: DNA & cDNA
Ncbi symbol: VTI1A
Origin species: Human
Product name: VTI1A-vesicle transport through interaction with t-SNAREs homolog 1A (yeast) Gene
Size: 2ug
Accessions: BC017052
Gene id: 143187
Gene description: vesicle transport through interaction with t-SNAREs homolog 1A (yeast)
Synonyms: SNARE Vti1a-beta protein; MMDS3; MVti1; VTI1RP2; Vti1-rp2; vesicle transport through interaction with t-SNAREs homolog 1A; vesicle transport v-SNARE protein Vti1-like 2; vesicle transport through interaction with t-SNAREs 1A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgtccgacttcgaaggttacgagcaggacttcgcggtgctcactgcagagatcaccagcaagattgcgagggtcccacgactcccgcctgatgaaaagaaacagatggttgcaaatgtggagaaacagcttgaagaagcgaaagaactgcttgaacagatggatttggaagtccgagagataccaccccaaagtcgagggatgtacagcaacagaatgagaagctacaaacaagaaatgggaaaactcgaaacagattttaaaaggtcacggatcgcctacagtgacgaagtacggaatgagctcctgggggatgatgggaattcctcagagaaccagagggcacatctgctcgataacacagagaggctggaaaggtcatctcggagactagaggctggataccaaatagcagtggaaaccgagcaaattggtcaggagatgttggaaaaccttagtcatgacagagaaaagatacagcgagcacgtgaaagacttcgggaaacagatgctaatttgggaaaaagctccaggattctgacagggatgttgcgaaggggttgttctgtgaaaaaacaatgtaacctgtctctggccccaaaggcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit
- solute carrier family 12 (potassium/chloride transporters), member 7
- solute carrier family 12 (potassium/chloride transporters), member 8
- X-ray repair complementing defective repair in Chinese hamster cells 4

Buy VTI1A-vesicle transport through interaction with t-SNAREs homolog 1A (yeast) Gene now

Add to cart