Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
VTI1A-vesicle transport through interaction with t-SNAREs homolog 1A (yeast) Gene
PTXBC017052
New product
Data sheet of VTI1A-vesicle transport through interaction with t-SNAREs homolog 1A (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about VTI1A-vesicle transport through interaction with t-SNAREs homolog 1A (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017052 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VTI1A |
| Origin species: | Human |
| Product name: | VTI1A-vesicle transport through interaction with t-SNAREs homolog 1A (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC017052 |
| Gene id: | 143187 |
| Gene description: | vesicle transport through interaction with t-SNAREs homolog 1A (yeast) |
| Synonyms: | SNARE Vti1a-beta protein; MMDS3; MVti1; VTI1RP2; Vti1-rp2; vesicle transport through interaction with t-SNAREs homolog 1A; vesicle transport v-SNARE protein Vti1-like 2; vesicle transport through interaction with t-SNAREs 1A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgtccgacttcgaaggttacgagcaggacttcgcggtgctcactgcagagatcaccagcaagattgcgagggtcccacgactcccgcctgatgaaaagaaacagatggttgcaaatgtggagaaacagcttgaagaagcgaaagaactgcttgaacagatggatttggaagtccgagagataccaccccaaagtcgagggatgtacagcaacagaatgagaagctacaaacaagaaatgggaaaactcgaaacagattttaaaaggtcacggatcgcctacagtgacgaagtacggaatgagctcctgggggatgatgggaattcctcagagaaccagagggcacatctgctcgataacacagagaggctggaaaggtcatctcggagactagaggctggataccaaatagcagtggaaaccgagcaaattggtcaggagatgttggaaaaccttagtcatgacagagaaaagatacagcgagcacgtgaaagacttcgggaaacagatgctaatttgggaaaaagctccaggattctgacagggatgttgcgaaggggttgttctgtgaaaaaacaatgtaacctgtctctggccccaaaggcttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit - solute carrier family 12 (potassium/chloride transporters), member 7 - solute carrier family 12 (potassium/chloride transporters), member 8 - X-ray repair complementing defective repair in Chinese hamster cells 4 |