XRCC4-X-ray repair complementing defective repair in Chinese hamster cells 4 Gene View larger

XRCC4-X-ray repair complementing defective repair in Chinese hamster cells 4 Gene

PTXBC005259

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of XRCC4-X-ray repair complementing defective repair in Chinese hamster cells 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about XRCC4-X-ray repair complementing defective repair in Chinese hamster cells 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005259
Product type: DNA & cDNA
Ncbi symbol: XRCC4
Origin species: Human
Product name: XRCC4-X-ray repair complementing defective repair in Chinese hamster cells 4 Gene
Size: 2ug
Accessions: BC005259
Gene id: 7518
Gene description: X-ray repair complementing defective repair in Chinese hamster cells 4
Synonyms: DNA repair protein XRCC4; SSMED; X-ray repair complementing defective repair in Chinese hamster cells 4; X-ray repair cross complementing 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagagaaaaataagcagaatccaccttgtttctgaacccagtataactcattttctacaagtatcttgggagaaaacactggaatctggttttgttattacacttactgatggtcattcagcatggactgggacagtttctgaatcagagatttcccaagaagctgatgacatggcaatggaaaaagggaaatatgttggtgaactgagaaaagcattgttgtcaggagcaggaccagctgatgtatacacgtttaatttttctaaagagtcttgttatttcttctttgagaaaaacctgaaagatgtctcattcagacttggttccttcaacctagagaaagttgaaaacccagctgaagtcattagagaacttatttgttattgcttggacaccattgcagaaaatcaagccaaaaatgagcacctgcagaaagaaaatgaaaggcttctgagagattggaatgatgttcaaggacgatttgaaaaatgtgtgagtgctaaggaagctttggagactgatctttataagcggtttattctggtgttgaatgagaagaaaacaaaaatcagaagtttgcataataaattattaaatgcagctcaagaacgagaaaaggacatcaaacaagaaggggaaactgcaatctgttctgaaatgactgctgaccgagatccagtctatgatgagagtactgatgaggaaagtgaaaaccaaactgatctctctgggttggcttcagctgctgtaagtaaagatgattccattatttcaagtcttgatgtcactgatattgcaccaagtagaaaaaggagacagcgaatgcaaagaaatcttgggacagaacctaaaatggctcctcaggagaatcagcttcaagaaaaggaaaaagggaggaagaaggagacttcagagaaagaggccgtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor)
- ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative function)
- protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform
- X-ray repair complementing defective repair in Chinese hamster cells 6

Buy XRCC4-X-ray repair complementing defective repair in Chinese hamster cells 4 Gene now

Add to cart