XRCC6-X-ray repair complementing defective repair in Chinese hamster cells 6 Gene View larger

XRCC6-X-ray repair complementing defective repair in Chinese hamster cells 6 Gene

PTXBC010034

New product

Data sheet of XRCC6-X-ray repair complementing defective repair in Chinese hamster cells 6 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about XRCC6-X-ray repair complementing defective repair in Chinese hamster cells 6 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC010034
Product type: DNA & cDNA
Ncbi symbol: XRCC6
Origin species: Human
Product name: XRCC6-X-ray repair complementing defective repair in Chinese hamster cells 6 Gene
Size: 2ug
Accessions: BC010034
Gene id: 2547
Gene description: X-ray repair complementing defective repair in Chinese hamster cells 6
Synonyms: DNA repair protein XRCC6; CTC75; CTCBF; G22P1; ML8; TLAA; X-ray repair cross-complementing protein 6; 5'-dRP lyase Ku70; 5'-deoxyribose-5-phosphate lyase Ku70; 70 kDa subunit of Ku antigen; ATP-dependent DNA helicase 2 subunit 1; ATP-dependent DNA helicase II, 70 kDa subunit; CTC box binding factor 75 kDa subunit; Ku autoantigen p70 subunit; Ku autoantigen, 70kDa; X-ray repair complementing defective repair in Chinese hamster cells 6; lupus Ku autoantigen protein p70; thyroid autoantigen 70kD (Ku antigen); thyroid autoantigen 70kDa (Ku antigen); thyroid-lupus autoantigen p70; X-ray repair cross complementing 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcagggtgggagtcatattacaaaaccgagggcgatgaagaagcagaggaagaacaagaagagaaccttgaagcaagtggagactataaatattcaggaagagatagtttgatttttttggttgatgcctccaaggctatgtttgaatctcagagtgaagatgagttgacaccttttgacatgagcatccagtgtatccaaagtgtgtacatcagtaagatcataagcagtgatcgagatctcttggctgtggtgttctatggtaccgagaaagacaaaaattcagtgaattttaaaaatatttacgtcttacaggagctggataatccaggtgcaaaacgaattctagagcttgaccagtttaaggggcagcagggacaaaaacgtttccaagacatgatgggccacggatctgactactcactcagtgaagtgctgtgggtctgtgccaacctctttagtgatgtccaattcaagatgagtcataagaggatcatgctgttcaccaatgaagacaacccccatggcaatgacagtgccaaagccagccgggccaggaccaaagccggtgatctccgagatacaggcatcttccttgacttgatgcacctgaagaaacctgggggctttgacatatccttgttctacagagatatcatcagcatagcagaggatgaggacctcagggttcactttgaggaatccagcaagctagaagacctgttgcggaaggttcgcgccaaggagaccaggaagcgagcactcagcaggttaaagctgaagctcaacaaagatatagtgatctctgtgggcatttataatctggtccagaaggctctcaagcctcctccaataaagctctatcgggaaacaaatgaaccagtgaaaaccaagacccggacctttaatacaagtacaggcggtttgcttctgcctagcgataccaagaggtctcagatctatgggagtcgtcagattatactggagaaagaggaaacagaagagctaaaacggtttgatgatccaggtttgatgctcatgggtttcaagccgttggtactgctgaagaaacaccattacctgaggccctccctgttcgtgtacccagaggagtcgctggtgattgggagctcaaccctgttcagtgctctgctcatcaagtgtctggagaaggaggttgcagcattgtgcagatacacaccccgcaggaacatccctccttattttgtggctttggtgccacaggaagaagagttggatgaccagaaaattcaggtgactcctccaggcttccagctggtctttttaccctttgctgatgataaaaggaagatgccctttactgaaaaaatcatggcaactccagagcaggtgggcaagatgaaggctatcgttgagaagcttcgcttcacatacagaagtgacagctttgagaaccccgtgctgcagcagcacttcaggaacctggaggccttggccttggatttgatggagccggaacaagcagtggacctgacattgcccaaggttgaagcaatgaataaaagactgggctccttggtggatgagtttaaggagcttgtttacccaccagattacaatcctgaagggaaagttaccaagagaaaacacgataatgaaggttctggaagcaaaaggcccaaggtggagtattcagaagaggagctgaagacccacatcagcaagggtacgctgggcaagttcactgtgcccatgctgaaagaggcctgccgggcttacgggctgaagagtgggctgaagaagcaggagctgctggaagccctcaccaagcacttccaggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
- nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1
- protein phosphatase 3 (formerly 2B), catalytic subunit, gamma isoform
- UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)

Buy XRCC6-X-ray repair complementing defective repair in Chinese hamster cells 6 Gene now

Add to cart