PPP3CA-protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform Gene View larger

PPP3CA-protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform Gene

PTXBC025714

New product

Data sheet of PPP3CA-protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PPP3CA-protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC025714
Product type: DNA & cDNA
Ncbi symbol: PPP3CA
Origin species: Human
Product name: PPP3CA-protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform Gene
Size: 2ug
Accessions: BC025714
Gene id: 5530
Gene description: protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform
Synonyms: CALN; CALNA; CALNA1; CCN1; CNA1; PPP2B; serine/threonine-protein phosphatase 2B catalytic subunit alpha isoform; CAM-PRP catalytic subunit; calcineurin A alpha; calmodulin-dependent calcineurin A subunit alpha isoform; protein phosphatase 2B, catalytic subunit, alpha isoform; protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform; protein phosphatase 3 catalytic subunit alpha isozyme; protein phosphatase 3 catalytic subunit alpha
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccgagcccaaggcaattgatcccaagttgtcgacgaccgacagggtggtgaaagctgttccatttcctccaagtcaccggcttacagcaaaagaagtgtttgataatgatggaaaacctcgtgtggatatcttaaaggcgcatcttatgaaggagggaaggctggaagagagtgttgcattgagaataataacagagggtgcatcaattcttcgacaggaaaaaaatttgctggatattgatgcgccagtcactgtttgtggggacattcatggacaattctttgatttgatgaagctctttgaagtcgggggatctcctgccaacactcgctacctcttcttaggggactatgttgacagagggtacttcagtattgaatgtgtgctgtatttgtgggccttgaaaattctctaccccaaaacactgtttttacttcgtggaaatcatgaatgtagacatctaacagagtatttcacatttaaacaagaatgtaaaataaagtattcagaacgcgtatatgatgcctgtatggatgcctttgactgccttcccctggctgccctgatgaaccaacagttcctgtgtgtgcatggtggtttgtctccagagattaacactttagatgatatcagaaaattagaccgattcaaagaaccacctgcatatggacctatgtgtgatatcctgtggtcagaccccctggaagattttggaaatgagaagactcaggaacatttcactcacaacacagtcagggggtgttcatacttctacagttacccggctgtatgtgaattcttacagcacaataacttgttatctatactccgagcccacgaagcccaagatgcagggtaccgcatgtacaggaaaagccaaacaacaggcttcccttctctaattacaattttttcagcaccaaattacttagatgtatacaataacaaagctgcagtattgaagtatgagaacaatgttatgaatatcaggcaattcaactgttctcctcatccatactggcttccaaatttcatggatgtttttacttggtcccttccatttgttggggaaaaagtgactgagatgctggtaaatgtcctcaacatctgctcagatgatgaactagggtcagaagaagatggatttgatggtgcaacagctgcagcccggaaagaggtgataaggaacaagatccgagcaataggcaaaatggccagagtgttctcagtgctcagagaagagagtgagagtgtgctgacgctgaaaggcttgaccccaactggcatgctccccagcggagtactttctggagggaagcaaaccctgcaaagcgctatcaaaggattttcaccacaacataagatcactagcttcgaggaagccaagggcttagaccgaattaatgagaggatgccgcctcgcagagatgccatgccctctgacgccaaccttaactccatcaacaaggctctcacctcagagactaacggcacggacagcaatggcagtaatagcagcaatattcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - X-ray repair complementing defective repair in Chinese hamster cells 6
- Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
- nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1
- protein phosphatase 3 (formerly 2B), catalytic subunit, gamma isoform

Buy PPP3CA-protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform Gene now

Add to cart