Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MC1R-melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor) Gene
PTXBC007856
New product
Data sheet of MC1R-melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MC1R-melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007856 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MC1R |
| Origin species: | Human |
| Product name: | MC1R-melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor) Gene |
| Size: | 2ug |
| Accessions: | BC007856 |
| Gene id: | 4157 |
| Gene description: | melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor) |
| Synonyms: | CMM5; MSH-R; SHEP2; melanocyte-stimulating hormone receptor; MC1-R; alpha melanocyte stimulating hormone receptor; melanotropin receptor; melanocortin 1 receptor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgtgcagggatcccagagaagacttctgggctccctcaactccacccccacagccatcccccagctggggctggctgccaaccagacaggagcccggtgcctggaggtgtccatctctgacgggctcttcctcagcctggggctggtgagcttggtggagaacgcgctggtggtggccaccatcgccaagaaccggaacctgcactcacccatgtactgcttcatctgctgcctggccttgtcggacctgctggtgagcgggagcaacgtgctggagacggccgtcatcctcctgctggaggccggtgcactggtggcccgggctgcggtgctgcagcagctggacaatgtcattgacgtgatcacctgcagctccatgctgtccagcctctgcttcctgggcgccatcgccgtggaccgctacatctccatcttctacgcactgcgctaccacagcaccgtgaccctgccgcgggcgcggcgagccgttgcggccatctgggtggccagtgtcgtcttcagcacgctcttcatcgcctactacgaccacgtggccgtcctgctgtgcctcgtggtcttcttcctggctatgctggtgctcatggccgtgctgtacgtccacatgctggcccgggcctgccagcacgcccagggcatcgcccggctccacaagaggcagcgcccggtccaccagggctttggccttaaaggcgctgtcaccctcaccatcctgctgggcattttcttcctctgctggggccccttcttcctgcatctcacactcatcgtcctctgccccgagcaccccacgtgcggctgcatcttcaagaacttcaacctctttctcgccctcatcatctgcaatgccatcatcgaccccctcatctacgccttccacagccaggagctccgcaggacgctcaaggaggtgctgacgtgctcctggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative function) - protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform - X-ray repair complementing defective repair in Chinese hamster cells 6 - Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) |