ENPP5-ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative function) Gene View larger

ENPP5-ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative function) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ENPP5-ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative function) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ENPP5-ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative function) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027615
Product type: DNA & cDNA
Ncbi symbol: ENPP5
Origin species: Human
Product name: ENPP5-ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative function) Gene
Size: 2ug
Accessions: BC027615
Gene id: 59084
Gene description: ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative function)
Synonyms: NPP-5; NPP5; ectonucleotide pyrophosphatase/phosphodiesterase family member 5; E-NPP 5; ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacttcgaaatttctcttggtgtccttcatacttgctgcactgagtctttcaaccaccttttctctccaaccagaccagcaaaaggttctactagtttcttttgatggattccgttgggattacttatataaagttccaacgccccattttcattatattatgaaatatggtgttcacgtgaagcaagttactaatgtttttattacaaaaacctaccctaaccattatactttggtaactggcctctttgcagagaatcatgggattgttgcaaatgatatgtttgatcctattcggaacaaatctttctccttggatcacatgaatatttatgattccaagttttgggaagaagcgacaccaatatggatcacaaaccagagggcaggacatactagtggtgcagccatgtggcccggaacagatgtaaaaatacataagcgctttcctactcattacatgccttacaatgagtcagtttcatttgaagatagagttgccaaaattattgaatggtttacgtcaaaagagcccataaatcttggtcttctctattgggaagaccctgatgacatgggccaccatttgggacctgacagtccgctcatggggcctgtcatttcagatattgacaagaagttaggatatctcatacaaatgctgaaaaaggcaaagttgtggaacactctgaacctaatcatcacaagtgatcatggaatgacgcagtgctctgaggaaaggttaatagaacttgaccagtacctggataaagaccactataccctgattgatcaatctccagtagcagccatcttgccaaaagaaggtaaatttgatgaagtctatgaagcactaactcacgctcatcctaatcttactgtttacaaaaaagaagacgttccagaaaggtggcattacaaatacaacagtcgaattcaaccaatcatagcagtggctgatgaagggtggcacattttacagaataagtcagatgactttctgttaggcaaccacggttacgataatgcgttagcagatatgcatccaatatttttagcccatggtcctgccttcagaaagaatttctcaaaagaagccatgaactccacagatttgtacccactactatgccacctcctcaatatcaccgccatgccacacaatggatcattctggaatgtccaggatctgctcaattcagcaatgccaagggtggtcccttatacacagagtactatactcctccctggtagtgttaaaccagcagaatatgaccaagaggggtcatacccttatttcataggggtctctcttggcagcattatagtgattgtattttttgtaattttcattaagcatttaattcacagtcaaatacctgccttacaagatatgcatgctgaaatagctcaaccattattacaagcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform
- X-ray repair complementing defective repair in Chinese hamster cells 6
- Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
- nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1

Buy ENPP5-ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative function) Gene now

Add to cart