Login to display prices
Login to display prices
DPM1-dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit Gene View larger

DPM1-dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit Gene

PTXBC007073

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DPM1-dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DPM1-dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit Gene

Proteogenix catalog: PTXBC007073
Ncbi symbol: DPM1
Product name: DPM1-dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit Gene
Size: 2ug
Accessions: BC007073
Gene id: 8813
Gene description: dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit
Synonyms: CDGIE; MPDS; dolichol-phosphate mannosyltransferase subunit 1; DPM synthase complex, catalytic subunit; DPM synthase subunit 1; MPD synthase subunit 1; dolichol monophosphate mannose synthase; dolichol-phosphate mannose synthase subunit 1; dolichyl-phosphate beta-D-mannosyltransferase subunit 1; dolichyl-phosphate mannosyltransferase polypeptide 1 catalytic subunit; mannose-P-dolichol synthase subunit 1; dolichyl-phosphate mannosyltransferase subunit 1, catalytic
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcctccttggaagtcagtcgtagtcctcgcaggtctcggcgggagctggaagtgcgcagtccacgacagaacaaatattcggtgcttttacctacctacaacgagcgcgagaacctgccgctcatcgtgtggctgctggtgaaaagcttctccgagagtggaatcaactatgaaattataatcatagatgatggaagcccagatggaacaagggatgttgctgaacagttggagaagatctatgggtcagacagaattcttctaagaccacgagagaaaaagttgggactaggaactgcatatattcatggaatgaaacatgccacaggaaactacatcattattatggatgctgatctctcacaccatccaaaatttattcctgaatttattaggaagcaaaaggagggtaattttgatattgtctctggaactcgctacaaaggaaatggaggtgtatatggctgggatttgaaaagaaaaataatcagccgtggggccaattttttaactcagatcttgctgagaccaggagcatctgatttaacaggaagtttcagattataccgaaaagaagttctagagaaattaatagaaaaatgtgtttctaaaggctacgtcttccagatggagatgattgttcgggcaagacagttgaattatactattggcgaggttccaatatcatttgtggatcgtgtttatggtgaatccaagttgggaggaaatgaaatagtatctttcttgaaaggattattgactctttttgctactacataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: